ID: 985406502

View in Genome Browser
Species Human (GRCh38)
Location 4:189643817-189643839
Sequence TTCTGTGCATGGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985406502_985406506 5 Left 985406502 4:189643817-189643839 CCTTTTTCCCTCCATGCACAGAA No data
Right 985406506 4:189643845-189643867 TCATAAAGAATAAGCATGAATGG No data
985406502_985406507 20 Left 985406502 4:189643817-189643839 CCTTTTTCCCTCCATGCACAGAA No data
Right 985406507 4:189643860-189643882 ATGAATGGAAACAACAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985406502 Original CRISPR TTCTGTGCATGGAGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr