ID: 985410656

View in Genome Browser
Species Human (GRCh38)
Location 4:189680027-189680049
Sequence GCTTTTAAGCAGATAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985410656_985410659 2 Left 985410656 4:189680027-189680049 CCTTCCTCTATCTGCTTAAAAGC No data
Right 985410659 4:189680052-189680074 GGAATAAATTTCCATTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985410656 Original CRISPR GCTTTTAAGCAGATAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr