ID: 985413403

View in Genome Browser
Species Human (GRCh38)
Location 4:189710847-189710869
Sequence CTCAAAAATTAGTTGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985413399_985413403 -6 Left 985413399 4:189710830-189710852 CCCATCTCTAGTAAAAACTCAAA No data
Right 985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG No data
985413400_985413403 -7 Left 985413400 4:189710831-189710853 CCATCTCTAGTAAAAACTCAAAA No data
Right 985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG No data
985413398_985413403 14 Left 985413398 4:189710810-189710832 CCTGGGTAACATGGTGAAATCCC 0: 27
1: 1542
2: 32136
3: 152221
4: 215368
Right 985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG No data
985413397_985413403 18 Left 985413397 4:189710806-189710828 CCATCCTGGGTAACATGGTGAAA 0: 137
1: 21813
2: 87737
3: 177620
4: 203883
Right 985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985413403 Original CRISPR CTCAAAAATTAGTTGGGCCA TGG Intergenic
No off target data available for this crispr