ID: 985413854

View in Genome Browser
Species Human (GRCh38)
Location 4:189716636-189716658
Sequence CTAACATTTTTGCAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985413852_985413854 -4 Left 985413852 4:189716617-189716639 CCTGCTTGACTCTTATTTTCTAA No data
Right 985413854 4:189716636-189716658 CTAACATTTTTGCAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985413854 Original CRISPR CTAACATTTTTGCAGGCTGC TGG Intergenic
No off target data available for this crispr