ID: 985416178

View in Genome Browser
Species Human (GRCh38)
Location 4:189737913-189737935
Sequence CAGGAAAATCAGAAGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985416176_985416178 -8 Left 985416176 4:189737898-189737920 CCTGAGTTTTGGAGGCAGGAAAA No data
Right 985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG No data
985416175_985416178 -7 Left 985416175 4:189737897-189737919 CCCTGAGTTTTGGAGGCAGGAAA No data
Right 985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985416178 Original CRISPR CAGGAAAATCAGAAGGATGC TGG Intergenic
No off target data available for this crispr