ID: 985419292

View in Genome Browser
Species Human (GRCh38)
Location 4:189767519-189767541
Sequence CCACAAATGGTGATGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985419282_985419292 19 Left 985419282 4:189767477-189767499 CCTGGATCCTCTTACCCACTGAG No data
Right 985419292 4:189767519-189767541 CCACAAATGGTGATGTGGTCAGG No data
985419284_985419292 12 Left 985419284 4:189767484-189767506 CCTCTTACCCACTGAGCTAGGAC No data
Right 985419292 4:189767519-189767541 CCACAAATGGTGATGTGGTCAGG No data
985419286_985419292 4 Left 985419286 4:189767492-189767514 CCACTGAGCTAGGACTGCATTCT No data
Right 985419292 4:189767519-189767541 CCACAAATGGTGATGTGGTCAGG No data
985419285_985419292 5 Left 985419285 4:189767491-189767513 CCCACTGAGCTAGGACTGCATTC No data
Right 985419292 4:189767519-189767541 CCACAAATGGTGATGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985419292 Original CRISPR CCACAAATGGTGATGTGGTC AGG Intergenic
No off target data available for this crispr