ID: 985421905

View in Genome Browser
Species Human (GRCh38)
Location 4:189792953-189792975
Sequence GGACGCAAGAGACTACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985421904_985421905 -8 Left 985421904 4:189792938-189792960 CCAATGAGGTTCACAGGACGCAA No data
Right 985421905 4:189792953-189792975 GGACGCAAGAGACTACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985421905 Original CRISPR GGACGCAAGAGACTACAAGC TGG Intergenic
No off target data available for this crispr