ID: 985421941

View in Genome Browser
Species Human (GRCh38)
Location 4:189793291-189793313
Sequence GACACTTTACTCAATACAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985421937_985421941 20 Left 985421937 4:189793248-189793270 CCGCACCTGGGAGGAGTTCTGGG No data
Right 985421941 4:189793291-189793313 GACACTTTACTCAATACAAGAGG No data
985421934_985421941 29 Left 985421934 4:189793239-189793261 CCGTCTTTACCGCACCTGGGAGG No data
Right 985421941 4:189793291-189793313 GACACTTTACTCAATACAAGAGG No data
985421939_985421941 15 Left 985421939 4:189793253-189793275 CCTGGGAGGAGTTCTGGGCATAG No data
Right 985421941 4:189793291-189793313 GACACTTTACTCAATACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985421941 Original CRISPR GACACTTTACTCAATACAAG AGG Intergenic
No off target data available for this crispr