ID: 985422236

View in Genome Browser
Species Human (GRCh38)
Location 4:189795773-189795795
Sequence GAGGATGCTGGATGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985422236_985422240 -6 Left 985422236 4:189795773-189795795 CCTTGCCCACATCCAGCATCCTC No data
Right 985422240 4:189795790-189795812 ATCCTCAGCATCCCGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985422236 Original CRISPR GAGGATGCTGGATGTGGGCA AGG (reversed) Intergenic
No off target data available for this crispr