ID: 985424192

View in Genome Browser
Species Human (GRCh38)
Location 4:189812549-189812571
Sequence GGGGAATAGCAAGTGATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985424192_985424201 25 Left 985424192 4:189812549-189812571 CCAGTGATCACTTGCTATTCCCC No data
Right 985424201 4:189812597-189812619 CCATGCCTTTACCTACCCATGGG No data
985424192_985424199 24 Left 985424192 4:189812549-189812571 CCAGTGATCACTTGCTATTCCCC No data
Right 985424199 4:189812596-189812618 TCCATGCCTTTACCTACCCATGG No data
985424192_985424196 -1 Left 985424192 4:189812549-189812571 CCAGTGATCACTTGCTATTCCCC No data
Right 985424196 4:189812571-189812593 CAAAGATTACCTGCACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985424192 Original CRISPR GGGGAATAGCAAGTGATCAC TGG (reversed) Intergenic
No off target data available for this crispr