ID: 985426024

View in Genome Browser
Species Human (GRCh38)
Location 4:189831333-189831355
Sequence ATTTCTTAAGGGCTGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985426016_985426024 -3 Left 985426016 4:189831313-189831335 CCAGGTAAAGCCTACCCCCAATT No data
Right 985426024 4:189831333-189831355 ATTTCTTAAGGGCTGTCCTGTGG No data
985426015_985426024 9 Left 985426015 4:189831301-189831323 CCTGAAATTATGCCAGGTAAAGC No data
Right 985426024 4:189831333-189831355 ATTTCTTAAGGGCTGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985426024 Original CRISPR ATTTCTTAAGGGCTGTCCTG TGG Intergenic
No off target data available for this crispr