ID: 985426228

View in Genome Browser
Species Human (GRCh38)
Location 4:189833356-189833378
Sequence TGCCAGACACCTAGTGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985426216_985426228 18 Left 985426216 4:189833315-189833337 CCGTCTGTTCCAGAAAGGGGGAC No data
Right 985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG No data
985426221_985426228 -8 Left 985426221 4:189833341-189833363 CCCCCAGGGTGGCCATGCCAGAC No data
Right 985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG No data
985426217_985426228 9 Left 985426217 4:189833324-189833346 CCAGAAAGGGGGACTATCCCCCA No data
Right 985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG No data
985426223_985426228 -10 Left 985426223 4:189833343-189833365 CCCAGGGTGGCCATGCCAGACAC No data
Right 985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG No data
985426222_985426228 -9 Left 985426222 4:189833342-189833364 CCCCAGGGTGGCCATGCCAGACA No data
Right 985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985426228 Original CRISPR TGCCAGACACCTAGTGGGCT CGG Intergenic
No off target data available for this crispr