ID: 985433798

View in Genome Browser
Species Human (GRCh38)
Location 4:189907798-189907820
Sequence GTCTTCTTCTAGGAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985433795_985433798 1 Left 985433795 4:189907774-189907796 CCAATGTCAAGAATGTTTTCTCC No data
Right 985433798 4:189907798-189907820 GTCTTCTTCTAGGAGTTTTATGG No data
985433794_985433798 7 Left 985433794 4:189907768-189907790 CCAAGACCAATGTCAAGAATGTT No data
Right 985433798 4:189907798-189907820 GTCTTCTTCTAGGAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985433798 Original CRISPR GTCTTCTTCTAGGAGTTTTA TGG Intergenic
No off target data available for this crispr