ID: 985434648

View in Genome Browser
Species Human (GRCh38)
Location 4:189917086-189917108
Sequence CCAGAAGACACCCAAAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985434648_985434652 1 Left 985434648 4:189917086-189917108 CCTTACCTTTGGGTGTCTTCTGG No data
Right 985434652 4:189917110-189917132 CGCCAATGTGCTGCAGGTCATGG No data
985434648_985434658 28 Left 985434648 4:189917086-189917108 CCTTACCTTTGGGTGTCTTCTGG No data
Right 985434658 4:189917137-189917159 GGAATCAAATTGGGCTCAAACGG 0: 1
1: 0
2: 1
3: 9
4: 119
985434648_985434655 18 Left 985434648 4:189917086-189917108 CCTTACCTTTGGGTGTCTTCTGG No data
Right 985434655 4:189917127-189917149 TCATGGCTCCGGAATCAAATTGG No data
985434648_985434660 30 Left 985434648 4:189917086-189917108 CCTTACCTTTGGGTGTCTTCTGG No data
Right 985434660 4:189917139-189917161 AATCAAATTGGGCTCAAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 59
985434648_985434651 -5 Left 985434648 4:189917086-189917108 CCTTACCTTTGGGTGTCTTCTGG No data
Right 985434651 4:189917104-189917126 TCTGGTCGCCAATGTGCTGCAGG No data
985434648_985434656 19 Left 985434648 4:189917086-189917108 CCTTACCTTTGGGTGTCTTCTGG No data
Right 985434656 4:189917128-189917150 CATGGCTCCGGAATCAAATTGGG No data
985434648_985434659 29 Left 985434648 4:189917086-189917108 CCTTACCTTTGGGTGTCTTCTGG No data
Right 985434659 4:189917138-189917160 GAATCAAATTGGGCTCAAACGGG 0: 1
1: 0
2: 1
3: 7
4: 77
985434648_985434654 7 Left 985434648 4:189917086-189917108 CCTTACCTTTGGGTGTCTTCTGG No data
Right 985434654 4:189917116-189917138 TGTGCTGCAGGTCATGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985434648 Original CRISPR CCAGAAGACACCCAAAGGTA AGG (reversed) Intergenic
No off target data available for this crispr