ID: 985437046

View in Genome Browser
Species Human (GRCh38)
Location 4:189940621-189940643
Sequence CTAGAGCAGCGGGCTGGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 6, 2: 2, 3: 11, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985437046_985437053 4 Left 985437046 4:189940621-189940643 CCGTCGCCAGCCCGCTGCTCTAG 0: 1
1: 6
2: 2
3: 11
4: 97
Right 985437053 4:189940648-189940670 AGGCGGTTCCACAGCGCACCCGG 0: 1
1: 1
2: 4
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985437046 Original CRISPR CTAGAGCAGCGGGCTGGCGA CGG (reversed) Intergenic
901110009 1:6786075-6786097 GGAGAGCAGGGGGCCGGCGAGGG - Intronic
901157322 1:7149440-7149462 CTACAGCAAGGGGCTGGAGAGGG - Intronic
902689725 1:18103061-18103083 CTCGAGCTGTGGGCTGGGGAAGG - Intergenic
905799381 1:40833582-40833604 CTAGAGCTGCAGGCTGGAGATGG - Intronic
906489272 1:46255425-46255447 CTATAGCAGGGGGCAGGGGAGGG - Intronic
911284593 1:95974664-95974686 CTAGAGAAGCAGTCTGGCCATGG + Intergenic
912500799 1:110120847-110120869 CTGGAGCACTGGGCTGGCTATGG - Intergenic
920301187 1:204990060-204990082 CTAGAGTGGTGGGCTGGGGAAGG - Intronic
1070539038 10:77402981-77403003 CTAGAGCATGGGCCTGGCTATGG + Intronic
1071561745 10:86650936-86650958 CCAGAGCAGGGGACAGGCGAAGG + Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1077134926 11:993744-993766 CTGGATCAGCGGGCTGGGGACGG - Exonic
1078437995 11:11341167-11341189 CTATAGCAGCAGGATGGCTATGG + Intronic
1080033810 11:27689872-27689894 CTGGAGCAGGGGGCAGGGGAAGG - Intronic
1083014922 11:59443551-59443573 GTAGAGAAGGGGGCTGGAGATGG - Exonic
1083300987 11:61739535-61739557 CCAGAGCCGCGTGCTGGCCAGGG - Exonic
1083553225 11:63606613-63606635 CCAGAGCAGCGAGCTGGAGGCGG + Intronic
1083858098 11:65403922-65403944 AAAGGGCAGTGGGCTGGCGAGGG - Intronic
1084087895 11:66862942-66862964 GGAGAGCAGGGGGCTGGCGGGGG + Intronic
1087163369 11:94973368-94973390 CTGGAGCAGCGGGCTAGGGGCGG - Intronic
1089670995 11:120056915-120056937 CTAGGGCAGCTGCCTGGCGAGGG + Intergenic
1090110824 11:123906805-123906827 GTAGAGCAGTGGGCTGCAGATGG - Exonic
1091587988 12:1827058-1827080 CTGGAGCAGTGGGCTGACGCAGG + Intronic
1092232227 12:6782644-6782666 CAAGAGAAGAGGGCTGGGGATGG - Intergenic
1094041269 12:26123323-26123345 CGAGAGAAGCGGGGTGGCGGAGG + Intronic
1096837003 12:54357468-54357490 CTAGAGCTGAGGGCTGCAGAAGG + Intergenic
1097277456 12:57823080-57823102 CTGCAGCAGCTGGCTGGAGAAGG + Exonic
1102497474 12:113329578-113329600 CTTGAGCAGAGAGCTGGGGAGGG - Intronic
1103593168 12:122006584-122006606 CTGGAGCAGAGAGCTGGCGCCGG - Intergenic
1103907520 12:124335192-124335214 CTGGAGCAGCGGGCTGGACGAGG + Exonic
1108247623 13:48533191-48533213 CAAGAGGAGGGGGCTGGCGACGG + Exonic
1109180014 13:59202464-59202486 CTTAAGCAGAGGGCTGGGGAAGG - Intergenic
1112429873 13:99342125-99342147 CTATGGGGGCGGGCTGGCGAAGG + Intronic
1113936164 13:113996214-113996236 CTAGAGAAGCAGGATGGCCACGG + Intronic
1127628820 15:60806260-60806282 CTCTAGCAGCTGGCTGGCCAAGG + Intronic
1128691380 15:69726984-69727006 CTAGAGCAGAGGGCAGGGGAGGG + Intergenic
1132079296 15:98851272-98851294 CTGGAGGAGAGGGCTGGCCAAGG + Intronic
1132623963 16:881235-881257 CAAGAGCCGTGGGCTGGGGAGGG + Intronic
1132769719 16:1554614-1554636 CTAGGACAGAGGGCTGGGGAAGG + Intronic
1132769730 16:1554659-1554681 CTAGGACAGAGGGCTGGGGAAGG + Intronic
1132769740 16:1554704-1554726 CTAGGACAGAGGGCTGGGGAAGG + Intronic
1135984463 16:27173881-27173903 CTGCAGCAGCGGGCTGGGCAGGG - Intergenic
1136776180 16:32873011-32873033 CTGGGGCAGGGGGCTGGAGATGG + Intergenic
1136894435 16:33988501-33988523 CTGGGGCAGGGGGCTGGAGATGG - Intergenic
1137270424 16:46899425-46899447 CTGGGGCAGAGGGCTGGGGAGGG + Intronic
1141694928 16:85614622-85614644 CGAGGGCAGCGTGCTGGCGGTGG + Intronic
1203078596 16_KI270728v1_random:1135120-1135142 CTGGGGCAGGGGGCTGGAGATGG + Intergenic
1143994808 17:10997229-10997251 CTGGGGCAGAGGGCTGGGGAAGG - Intergenic
1152111036 17:78357937-78357959 CCAGGGCTGCGGGCTGGCGAAGG - Exonic
1152140759 17:78535024-78535046 CTAGACCAGCAGGCTTTCGAGGG + Intronic
1156362384 18:36394452-36394474 CTAGTGCTGCGGGGTGGGGATGG - Intronic
1163720441 19:18895973-18895995 CTGGGGCAGCGCGCTGGCGGCGG - Exonic
1163722160 19:18903474-18903496 CTAGGGGAGGGGGCTGGCGGGGG - Intronic
1165015888 19:32879758-32879780 CTAGAGCGTCTGGCTGGCCAAGG - Intronic
1165166857 19:33863190-33863212 CTGGAGCAGGGGCCTGGAGAGGG + Intergenic
1165776077 19:38405076-38405098 CTGCAGCAGCTGGCTGGCGGGGG - Exonic
927723902 2:25406030-25406052 GAAGAGCAGGAGGCTGGCGATGG + Intronic
931142970 2:59484217-59484239 CTAAAACAGCGAGCTGGTGAGGG - Intergenic
934915468 2:98298009-98298031 CTGGAGCAGCGGGCAGGGCATGG - Exonic
937569198 2:123334893-123334915 CAAGGGCAGCGTGCTGGCAAAGG - Intergenic
947535548 2:230938667-230938689 CTGGAGCAGCGGGCAGGGCAAGG + Intronic
948384881 2:237575139-237575161 CAAGAGGAGGGGGCTGGCTAGGG + Intronic
948473793 2:238203633-238203655 CGGCAGCAGCGGGCGGGCGACGG + Exonic
1171724433 20:28603045-28603067 CTAGAGCTGCGGGCTGGCGACGG + Intergenic
1171753627 20:29080000-29080022 CTAGAGCTGCGGGCTGGCGACGG - Intergenic
1171788626 20:29497547-29497569 CTAGAGCTGCGGGCTGGTGACGG + Intergenic
1171858910 20:30376953-30376975 CTAGAGATGCGGGCTGGCGACGG - Intergenic
1172125657 20:32623799-32623821 CCCGAGCAGCGGGCAGGCTAGGG + Intergenic
1172424375 20:34845309-34845331 GTAGAGCAGCGGGGTGGGGCGGG - Exonic
1175539220 20:59737907-59737929 GCAGAGCTGAGGGCTGGCGAGGG - Intronic
1180297979 22:10961719-10961741 CTAGAGCTGCGGGCTGGCGACGG + Intergenic
1180410429 22:12602077-12602099 CTAGAGCTGCGGGCTGGCGAAGG - Intergenic
1181886255 22:26024564-26024586 TTACAGCAGCGGTCTGGTGACGG - Intronic
1183510082 22:38229602-38229624 CTAGAGCAGCTGGATTGCCAAGG + Intronic
1184210211 22:43030901-43030923 GGAGAGCAGCAGGCGGGCGAGGG - Intergenic
1184368418 22:44067564-44067586 ATGGAGCACTGGGCTGGCGAGGG + Intronic
1184710384 22:46246246-46246268 CGTGAGCAGCGGGGTGGCGGGGG - Intronic
950863706 3:16172426-16172448 CTCAAGCAGTGGGCTGGCCAGGG + Intergenic
953956693 3:47236854-47236876 CAAGAGCAGAGGGCAGGGGAAGG + Intronic
961171685 3:124801843-124801865 CAAGAGGAGTGGGCTGGGGAGGG - Intronic
961373216 3:126445272-126445294 CAACAGCAGAGGGCTGGCAAAGG + Intronic
963744810 3:149115491-149115513 CTAGGGCAGGAGGCTGGGGAGGG - Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
969219951 4:5752947-5752969 CTGGAGCTGCTGGCTGGTGAGGG + Exonic
969556530 4:7915171-7915193 CTAGAGCAGCTGGCTGGGCGCGG - Intronic
972726621 4:41751079-41751101 GCAGAGGAGCGGGCTGGCGGTGG - Intergenic
974953967 4:68616222-68616244 CTGGAGCAGCGGGCTCCAGACGG - Intronic
980481610 4:133395167-133395189 CTGGAGCCACGGGCTGGAGAGGG + Intergenic
985326980 4:188781959-188781981 CTAGAGGAGGGGGCTGGAGAAGG - Intergenic
985437046 4:189940621-189940643 CTAGAGCAGCGGGCTGGCGACGG - Intergenic
985448372 4:190041123-190041145 CAAGAGCAGGGGGACGGCGATGG - Intergenic
985638343 5:1051319-1051341 CTGGAGCACCGGGGTGGGGATGG + Exonic
994679351 5:102866025-102866047 CGAGAGCAGCGAGCTGGCCGCGG - Exonic
1000088896 5:157912727-157912749 CTAGGGCAGTGGGGTGGGGAAGG - Intergenic
1003097237 6:3151989-3152011 CTTGAGCAGCAGGCTGGGGATGG + Intronic
1003296112 6:4830397-4830419 ATATAGCAGGGGGCTGGGGAAGG - Intronic
1010489036 6:76452479-76452501 CTGGAGCCGCGGGCTGGAGTGGG - Intergenic
1017025220 6:150175568-150175590 CTTGAGCATGGGGCTGGTGAGGG + Intronic
1022088395 7:27090982-27091004 CTAGAGGAGGGGGCAGGAGAAGG + Intergenic
1022094442 7:27130197-27130219 CAAGAGCAGCGGGCACGCGGGGG + Exonic
1023853427 7:44163815-44163837 CTAGAGCAGCTGGCTGGAGCAGG + Intronic
1025942022 7:66081922-66081944 CTACAGCAGGGGCCTGGAGAAGG + Exonic
1029258380 7:99284781-99284803 GTAGACCAGCAAGCTGGCGAGGG - Intergenic
1031134855 7:117873406-117873428 CTAGAGCAGGAAGATGGCGACGG - Exonic
1032246967 7:130221551-130221573 CTAGAGCTGCTGGCTGGGCATGG + Intergenic
1036726422 8:11224787-11224809 CCAGAGCAGTAGGCTGGGGATGG - Intergenic
1040572115 8:48620390-48620412 CTAGAGCATTGGCCTGGCGTAGG + Intergenic
1049425244 8:142535266-142535288 CTGGAGCAGAGGGCTGGCACTGG + Intronic
1052856574 9:33410714-33410736 CTTGAGCTCCGGGCTGGAGATGG - Intergenic
1053042404 9:34885698-34885720 CAAGAGCATGGGGCTGGAGATGG - Intergenic
1053725163 9:40992036-40992058 CTAGAGCTGCGGGCTGGCGACGG - Intergenic
1054340789 9:63859858-63859880 CTAGAGCTGTGGGCTGGTGACGG + Intergenic
1060222611 9:121772689-121772711 CTCGAGCTGCGGGCAGGTGAGGG - Exonic
1061056465 9:128225363-128225385 CTAGAGCAGGGAGCTGGAGAGGG + Intronic
1203449640 Un_GL000219v1:99854-99876 CTAGAGCTGCGGGCTGGCGACGG + Intergenic
1185750968 X:2609363-2609385 CGAGTGCAGCGCGCGGGCGAAGG - Intergenic
1187868213 X:23743041-23743063 CTAGAGCTTCGGGCTGGCCCCGG - Intronic