ID: 985438156

View in Genome Browser
Species Human (GRCh38)
Location 4:189954043-189954065
Sequence CTCAATAGAAAAATGGACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2107
Summary {0: 1, 1: 14, 2: 71, 3: 379, 4: 1642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985438152_985438156 6 Left 985438152 4:189954014-189954036 CCCAGTAGAAAAACTGCGAACAA 0: 1
1: 6
2: 3
3: 10
4: 185
Right 985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG 0: 1
1: 14
2: 71
3: 379
4: 1642
985438151_985438156 7 Left 985438151 4:189954013-189954035 CCCCAGTAGAAAAACTGCGAACA 0: 1
1: 7
2: 1
3: 12
4: 99
Right 985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG 0: 1
1: 14
2: 71
3: 379
4: 1642
985438153_985438156 5 Left 985438153 4:189954015-189954037 CCAGTAGAAAAACTGCGAACAAT 0: 1
1: 6
2: 4
3: 11
4: 100
Right 985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG 0: 1
1: 14
2: 71
3: 379
4: 1642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985438156 Original CRISPR CTCAATAGAAAAATGGACAA GGG Intronic
Too many off-targets to display for this crispr