ID: 985444653

View in Genome Browser
Species Human (GRCh38)
Location 4:190015335-190015357
Sequence CTGGGCTTCGGCTGGGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985444653_985444666 16 Left 985444653 4:190015335-190015357 CCTGCGCCCCAGCCGAAGCCCAG No data
Right 985444666 4:190015374-190015396 TCCGCCACTGCAGCACCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985444653 Original CRISPR CTGGGCTTCGGCTGGGGCGC AGG (reversed) Intergenic
No off target data available for this crispr