ID: 985449706

View in Genome Browser
Species Human (GRCh38)
Location 4:190054000-190054022
Sequence TCTTGGGTGGACAGGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985449698_985449706 10 Left 985449698 4:190053967-190053989 CCTCCAGCTACCAGTTGTTTTTG No data
Right 985449706 4:190054000-190054022 TCTTGGGTGGACAGGCAAACAGG No data
985449699_985449706 7 Left 985449699 4:190053970-190053992 CCAGCTACCAGTTGTTTTTGCTT No data
Right 985449706 4:190054000-190054022 TCTTGGGTGGACAGGCAAACAGG No data
985449701_985449706 0 Left 985449701 4:190053977-190053999 CCAGTTGTTTTTGCTTAGGATTG No data
Right 985449706 4:190054000-190054022 TCTTGGGTGGACAGGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985449706 Original CRISPR TCTTGGGTGGACAGGCAAAC AGG Intergenic
No off target data available for this crispr