ID: 985450904

View in Genome Browser
Species Human (GRCh38)
Location 4:190061632-190061654
Sequence AATGGTGACCTGAGAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 2, 1: 13, 2: 2, 3: 15, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985450904_985450909 30 Complete closest: 30
total_pairs: 16
max_distance: 1000
Left 985450904 4:190061632-190061654 CCCTCAACTCTCAGGTCACCATT 0: 2
1: 13
2: 2
3: 15
4: 198
Right 985450909 4:190061685-190061707 GCAGTTAACCCTGCTGAAAGTGG 0: 2
1: 0
2: 13
3: 2
4: 116
985450904_985450907 -7 Complete closest: -7
total_pairs: 15
max_distance: 1000
Left 985450904 4:190061632-190061654 CCCTCAACTCTCAGGTCACCATT 0: 2
1: 13
2: 2
3: 15
4: 198
Right 985450907 4:190061648-190061670 CACCATTGGAGAAGATGCTCAGG 0: 15
1: 0
2: 1
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985450904 Original CRISPR AATGGTGACCTGAGAGTTGA GGG (reversed) Intergenic
900821288 1:4890863-4890885 GATGATGACCTCAGAATTGATGG + Intergenic
902038928 1:13478573-13478595 AAGGTTTTCCTGAGAGTTGAAGG - Intronic
905923384 1:41733523-41733545 AAAGCTCACCTGAGAGTTGGTGG + Intronic
907267483 1:53271706-53271728 CCTCGTGACCTCAGAGTTGAAGG + Intronic
913429737 1:118777316-118777338 AATGTTGAGCTGAGTATTGAGGG - Intergenic
914844112 1:151271568-151271590 AAGGATCATCTGAGAGTTGAAGG - Intergenic
915257641 1:154646898-154646920 AATTTTGACATGAGATTTGAAGG + Intergenic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
916409658 1:164533463-164533485 AATGTTGAGCTGAGGTTTGAAGG - Intergenic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
1062974475 10:1673120-1673142 AATACTGACCTGAGAGTTGATGG + Intronic
1063315265 10:4998302-4998324 AAAGATGACCAGAGAGTGGACGG - Intronic
1064348611 10:14556353-14556375 AATGCTGACCTCAGAGTTTCTGG + Intronic
1065081839 10:22136842-22136864 AATGGTGAGCTAAGATTTGCTGG + Intergenic
1065999921 10:31095123-31095145 AATAGTGATCTGAGAGGAGATGG + Intergenic
1068565591 10:58571172-58571194 AATGGTGTCCTAAGAATTCAGGG + Intronic
1072387021 10:94941357-94941379 AATGGGGACCTGGGAGATGGAGG - Intronic
1072591239 10:96830832-96830854 AATACTGTCCTGAGTGTTGAAGG - Intergenic
1074960694 10:118442677-118442699 AATGGTGACCTCAAAGTAGAGGG + Intergenic
1075446831 10:122519089-122519111 AATGGAGAGGTGAGAGTGGAAGG - Intergenic
1075791140 10:125085097-125085119 GGTGGTGACGTGAGGGTTGAAGG - Intronic
1076947449 10:133660832-133660854 AATGGTGACCTGAGAGTTGAGGG - Intergenic
1077005067 11:351099-351121 AAGGGGAACCTGAGAGCTGATGG - Intergenic
1080324842 11:31058584-31058606 AATGGTGATCAGAGATATGATGG + Intronic
1080328468 11:31107377-31107399 ACTGGTTACCTGAGATTTGCTGG - Intronic
1080832616 11:35910207-35910229 AATGTTTGCCTGATAGTTGAGGG + Intergenic
1082900332 11:58242659-58242681 AATGTTGAGCTGAGGGTTTAAGG - Intergenic
1088086022 11:105981481-105981503 AATGGGATCTTGAGAGTTGATGG - Exonic
1088131134 11:106492408-106492430 AATTGTGACCTGAGTTTTGGAGG - Intergenic
1091129987 11:133137990-133138012 AATTTTAACCTGAGTGTTGATGG - Intronic
1095998282 12:48107673-48107695 AAGGAGGACTTGAGAGTTGAGGG + Intronic
1100498269 12:95146112-95146134 AATGGTGGCCCAAGAGGTGAGGG - Intronic
1100800470 12:98225317-98225339 AACTGTTACCTGAGGGTTGATGG + Intergenic
1103256500 12:119545991-119546013 AATGGGGGTCTGAGAGTTGGAGG - Intergenic
1107979848 13:45724307-45724329 ATTGTTGAACTGAGACTTGAAGG - Intergenic
1108574426 13:51779240-51779262 AATGGGGGCCAGAGTGTTGAAGG - Intronic
1113366786 13:109683970-109683992 AAAAGTAACCTGAAAGTTGAGGG + Intergenic
1114646320 14:24258478-24258500 AATGGTGACCTGAGCTTTGGAGG - Intronic
1116521279 14:45850271-45850293 GATGAGGACCTGAGAGGTGAAGG - Intergenic
1120144090 14:80960509-80960531 AATTCTGACCTGAAAGTTAAAGG + Intronic
1120144195 14:80961514-80961536 AATTCTGACCTGAAAGCTGAAGG + Intronic
1121532713 14:94668854-94668876 CATGGTCTCATGAGAGTTGATGG - Intergenic
1121896014 14:97648536-97648558 AAGGGTGACCTGAGATGGGAGGG - Intergenic
1124076577 15:26451321-26451343 AATGATGAGGTGAGAGTTGGTGG - Intergenic
1124946287 15:34270113-34270135 AATGGTGACCAGTTAGTTGTGGG + Intronic
1126174116 15:45719670-45719692 AATGTTGACCTTGGAGATGAGGG + Intergenic
1127394674 15:58534997-58535019 GAGGATGACATGAGAGTTGAAGG - Intronic
1128491442 15:68150083-68150105 AATGGTGACATATGAGTTAAAGG - Intronic
1128752521 15:70159478-70159500 AATGGGGCCCAGAGAGATGAAGG + Intergenic
1130144528 15:81263785-81263807 AAGGGTGACCTGTGACTTGAAGG - Intronic
1131596158 15:93800421-93800443 AATGCAAACCTGAGAGATGATGG - Intergenic
1131686982 15:94778881-94778903 AATGGAGACCAGAGTGTTGCAGG + Intergenic
1131907366 15:97157488-97157510 AATGGTGATCTGAGAGTGAAGGG - Intergenic
1133961545 16:10497816-10497838 AGTGGTGACCACAGGGTTGACGG - Intergenic
1140015614 16:71179888-71179910 AATGATGCCCTGTGAGTTCACGG + Intronic
1141239605 16:82253313-82253335 CATGGTAATCTGGGAGTTGATGG - Intergenic
1142499557 17:324530-324552 ACTGGTGAGCTGAGAGACGAGGG - Intronic
1143272442 17:5685791-5685813 AATGGTGACCTCAGTGTTACAGG + Intergenic
1144889182 17:18484177-18484199 AATGGGGCCCTGGGAGCTGAAGG + Intronic
1145143026 17:20460119-20460141 AATGGGGCCCTGGGAGCTGAAGG - Intronic
1145792847 17:27638566-27638588 AATGGGGCCCTGGGAGCTGACGG + Intronic
1145807713 17:27746435-27746457 AATGGGGCCCTGGGAGCTGACGG + Intergenic
1145875602 17:28316791-28316813 AAGGCTGACCTGAGACTTGGGGG + Intergenic
1148155212 17:45420437-45420459 AGTGGTGACTTTTGAGTTGATGG + Intronic
1149214314 17:54336212-54336234 AATGGTCTCATGAGATTTGATGG + Intergenic
1151563359 17:74882862-74882884 CATAGATACCTGAGAGTTGATGG - Intronic
1152271966 17:79330015-79330037 AATGGAGAGCTGAGAGATGCAGG - Intronic
1203171347 17_GL000205v2_random:149830-149852 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1153864660 18:9253320-9253342 AATGGGGAGATGAGAGTTAATGG - Intronic
1156941954 18:42778630-42778652 AATGGTGACTGCAGAGTTGCTGG - Intronic
1157335662 18:46735543-46735565 ATTGGTGAAATGAGAATTGATGG + Intronic
1159486582 18:69067652-69067674 AATGATAAACTGAGACTTGAGGG - Intergenic
1160449081 18:78949631-78949653 CATCGTGCCATGAGAGTTGAAGG - Intergenic
1161625368 19:5323497-5323519 AAAAGTGACCTGAGACGTGAAGG + Intronic
1163244610 19:16085506-16085528 AGTGGTGCCCTGAGAGCTCACGG - Intronic
1163519087 19:17781332-17781354 AATGGGGACCTGGTAGGTGAGGG + Exonic
1164156672 19:22601565-22601587 AACGGTGACCTGGGAGTAGAGGG + Intergenic
1166106878 19:40601909-40601931 AATGGGGATCTCAGAATTGAGGG + Intronic
1166339739 19:42130537-42130559 AATGGGGACCTCAGAGGTGCTGG - Intronic
1168435729 19:56315434-56315456 AGTGGTGCCCTGGGAGATGAGGG + Intronic
927847771 2:26480204-26480226 TATGGTGACCTCAAAGGTGATGG + Exonic
929043866 2:37772211-37772233 ACTGGGGACCTGAGAGGAGAAGG - Intergenic
930351105 2:50255536-50255558 ATTGGGGACCTGAGTGTTCAAGG - Intronic
930674826 2:54189143-54189165 AATGGTCAACTGTGAGATGATGG - Intronic
931014858 2:57964794-57964816 AAGGATCACCTGAGAGGTGAAGG + Intronic
931312936 2:61099799-61099821 AATGTTGCCATGAAAGTTGAGGG + Intronic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
933228103 2:79774185-79774207 AATGCTGACATGAGAGAAGAAGG + Intronic
934646404 2:96061657-96061679 TATGGTGGCCTGGGAGGTGAAGG + Intergenic
934956959 2:98631189-98631211 AGTGGAGACCCGAGGGTTGATGG - Intronic
935661636 2:105471683-105471705 AATGTTGACCTGAGGGATGTGGG + Intergenic
936684467 2:114811627-114811649 AATGGTGACATGAGGGGTGAGGG - Intronic
938026236 2:127951381-127951403 AATGGTGACAGGAAAGTTTAGGG - Intronic
938414379 2:131092475-131092497 AAGGATGACCTGAAAGTTTAAGG + Intronic
938956804 2:136306517-136306539 AATGGTCATGTGAGAGTTCAGGG + Intergenic
940334668 2:152513263-152513285 AACGGTAACTTGAGAGATGATGG - Intronic
941880776 2:170478004-170478026 AATGCAGACATGATAGTTGAAGG - Intronic
942220738 2:173766742-173766764 AATGATGCCCTGAGACTGGAGGG + Intergenic
942668376 2:178347197-178347219 AATGGGGTCATGAGAGTTGGCGG - Intronic
943707521 2:191051124-191051146 AATGGTGACCTGAGGTTTCAAGG + Intronic
943981842 2:194562203-194562225 AATGTTGACCTGAGAATTTCAGG - Intergenic
944442390 2:199755459-199755481 AATGGTGAACCTAGAGTTCAAGG - Intergenic
944966480 2:204940329-204940351 GGTGGTGATCTGAGAGTTAAAGG + Intronic
945852446 2:215025459-215025481 AATGGTGACAAAAGAGTTTATGG - Intronic
947908417 2:233784508-233784530 AAATGTGACCTCAGAGTTGGAGG + Intronic
1169215109 20:3789053-3789075 AATGGTCACTTGAGAGGGGATGG - Intronic
1169323709 20:4657445-4657467 AGTGAGGACCAGAGAGTTGAGGG - Intergenic
1170279394 20:14628407-14628429 AATGGAATCCTGAGATTTGAAGG + Intronic
1170848341 20:19981265-19981287 GAAGGTGACCTCAGAGGTGAAGG + Intronic
1170914200 20:20606572-20606594 AATTTTGACCTGAGAAATGAGGG - Intronic
1172330424 20:34072127-34072149 AATGAAGACTCGAGAGTTGATGG - Exonic
1174792917 20:53497189-53497211 AATGGAAACCTGGGTGTTGAAGG - Intergenic
1175487114 20:59354408-59354430 AGTGGTAAGCTGAGAGTGGAGGG - Intergenic
1176327331 21:5511658-5511680 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176330378 21:5544573-5544595 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176397379 21:6276378-6276400 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176400426 21:6309293-6309315 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176436731 21:6679811-6679833 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176439778 21:6712726-6712748 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176460993 21:7006881-7006903 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176464040 21:7039795-7039817 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176484554 21:7388659-7388681 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176487601 21:7421574-7421596 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1178541205 21:33452285-33452307 CATGGTGGTCTGAGAGTGGAGGG + Intronic
1184254471 22:43279205-43279227 AAAGGTTACCTGAGAGTTTTAGG - Intronic
1184731868 22:46375036-46375058 AAGGGTGACCTGCGAGGTGGGGG + Intronic
1185391090 22:50562211-50562233 AACGGTGACGTGAGCGATGAGGG + Intronic
949342435 3:3044527-3044549 TATGGTGACCTCAGAGTAGTCGG + Intronic
950623173 3:14224266-14224288 AATGATGACCTTAGAATTCATGG + Intergenic
951634575 3:24759009-24759031 AATATTGACCTGAGAATTTAGGG + Intergenic
952848573 3:37709526-37709548 AATGATGACCTGAGAGTGTGAGG + Intronic
954508960 3:51105148-51105170 AATGGTGAAATCAGAGATGAGGG + Intronic
954863732 3:53711681-53711703 AATGCTGAGCTGAGAGGTTATGG + Intronic
954907511 3:54075384-54075406 TATATTGACATGAGAGTTGAAGG - Intergenic
955226662 3:57065893-57065915 ACTGAAGACCTGAGAGTTCATGG - Intronic
957642926 3:82881903-82881925 AATTGGAACCTGAGAGCTGAAGG + Intergenic
960823969 3:121763095-121763117 AAGGATGAACTGACAGTTGAAGG - Intergenic
963017928 3:140843405-140843427 AATGAGGAACTGAGAGTAGAGGG + Intergenic
963485188 3:145927009-145927031 AAGGGAGACCTGAGAGTAGATGG + Intergenic
964955651 3:162352842-162352864 AAGCGTGAGCTGAGAGTTCAAGG - Intergenic
966818341 3:183906767-183906789 AATGGATACCTGAGGGTCGAAGG + Intergenic
968878576 4:3286973-3286995 GATGGTGATCTGGGACTTGATGG + Intergenic
970512311 4:16793466-16793488 AATGGCAACCTGGGAGCTGATGG - Intronic
971550337 4:27947124-27947146 AATTGTGACTTGAGAATTAATGG + Intergenic
971960186 4:33476594-33476616 AATGTTTACCTTAGAGTTGTAGG - Intergenic
972668646 4:41192789-41192811 AATGGGGAACTGTGAGATGATGG + Intronic
975036009 4:69683069-69683091 AATGGTGACTTGATAATTAAAGG + Intergenic
976612777 4:87047082-87047104 AAAGGTGACCGAAGAGCTGACGG + Exonic
977572254 4:98640853-98640875 AATGCTGACGTGATAATTGAGGG - Intronic
979093362 4:116516099-116516121 AAGGCTGCCCTGAGAGCTGAAGG - Intergenic
981817509 4:148847695-148847717 AGTGGAGACCTGGGAGTGGAAGG + Intergenic
982134423 4:152259595-152259617 AATTTTGAGCTGAGAGCTGAGGG - Intergenic
982652365 4:158102015-158102037 AATGGTGCCCAGAGAGGTTAAGG - Intergenic
982849690 4:160296854-160296876 AATGGGAAACTGAGACTTGAAGG - Intergenic
983052153 4:163061121-163061143 AATGCTGTCCTGAGAGAGGATGG - Intergenic
984184707 4:176529762-176529784 AGTGGTTACCAGAGAGATGAGGG - Intergenic
985130785 4:186736613-186736635 AATGGTCACTTCAGTGTTGACGG + Intergenic
985338043 4:188916926-188916948 AATGGTCACCTGAGACTTCAGGG + Intergenic
985450904 4:190061632-190061654 AATGGTGACCTGAGAGTTGAGGG - Intergenic
989249289 5:39290059-39290081 AATACTGAGCTGAGATTTGAAGG + Intronic
991203075 5:64016792-64016814 AATAGGGAACTGCGAGTTGATGG - Intergenic
994049864 5:95350053-95350075 AATGATGATCTCAGTGTTGATGG - Intergenic
998061831 5:139124983-139125005 AGTTGTGCCCTGAGAGCTGAGGG + Intronic
998266734 5:140672618-140672640 AAGTGTGAGCTGAGCGTTGACGG - Exonic
998322663 5:141247074-141247096 AATGGAGACCAGGGAGGTGAGGG - Exonic
999216149 5:149937129-149937151 AATGCTGAGCTAAGAGCTGAAGG + Intronic
999929603 5:156416681-156416703 AAAGGAGACCAGAGAGATGAAGG - Intronic
1001121234 5:168981878-168981900 AATGATCACCTAAGAGTTAATGG - Intronic
1002963126 6:1936316-1936338 AATGGTGCATTGAGACTTGAAGG + Intronic
1003234655 6:4284771-4284793 AATGGTGACCTGACAGTGCCTGG - Intergenic
1006623402 6:35383149-35383171 AATGGATACCTGAGTGGTGAGGG + Intronic
1007283866 6:40733412-40733434 AGTGGTTGCCTGAAAGTTGAAGG + Intergenic
1010056383 6:71570318-71570340 AAGAGTTTCCTGAGAGTTGAAGG + Intergenic
1011729551 6:90247029-90247051 AACGGTAACCTGACATTTGAAGG - Intronic
1015253824 6:131155705-131155727 AAAGGTGACCTGTGAGTTTTTGG + Intronic
1016411516 6:143788170-143788192 AATGGGGAGGGGAGAGTTGATGG - Intronic
1016749874 6:147620670-147620692 ACTGGTGTGCTGGGAGTTGAAGG + Intronic
1016856511 6:148676176-148676198 AATGGTGTCACGGGAGTTGAAGG - Intergenic
1018881990 6:167893152-167893174 AAGGGTGACCTAAGGGTTGGTGG + Intronic
1019783383 7:2958120-2958142 GATGGTGACCTGAGACTTGGCGG - Intronic
1020279970 7:6645156-6645178 AAAGGGGGCCTTAGAGTTGAAGG - Intronic
1022281687 7:28917234-28917256 AATGGTGAGATGAGGGATGAGGG - Intergenic
1023968220 7:44974445-44974467 ACTGGGGAGCTGAGAGTTGGTGG + Intronic
1024674841 7:51629075-51629097 AATCTTGAGCTTAGAGTTGATGG + Intergenic
1025853848 7:65262170-65262192 AATGGTGACCTGAGAGGGGTGGG + Intergenic
1031055255 7:116986271-116986293 GGTGGTGAATTGAGAGTTGAGGG + Intronic
1032921921 7:136558639-136558661 AGAGGTAACCTGAGAGTTGTGGG + Intergenic
1035855520 8:2972485-2972507 AAAGGTGAACTGAGAGGTGATGG - Intronic
1039337462 8:36607703-36607725 AATGGGGCCCTGAGTTTTGAAGG - Intergenic
1040356776 8:46625976-46625998 ACTGGAGTCCAGAGAGTTGAGGG + Intergenic
1040395523 8:46996528-46996550 ACTTGTGAGCTGAGAGGTGATGG + Intergenic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1041467225 8:58168863-58168885 AATTTTGACATGAGATTTGAAGG - Intronic
1041480275 8:58312366-58312388 GATGTGGATCTGAGAGTTGAGGG - Intergenic
1041673854 8:60517834-60517856 TATTCTGACGTGAGAGTTGAAGG - Intronic
1041698617 8:60763523-60763545 AGTGGTGACCTCCCAGTTGATGG + Intronic
1042572600 8:70183039-70183061 AATGGAGTACTGAGAGGTGAAGG + Intronic
1044970829 8:97617929-97617951 AATGGTGACCTCAGAGGGTAGGG - Intergenic
1045339901 8:101244299-101244321 AATGGTAACCCCAGTGTTGAAGG - Intergenic
1048959965 8:139568274-139568296 AAAGGGGACCTGACATTTGACGG - Intergenic
1049295325 8:141830380-141830402 AATAGTGACCTGAAGGCTGAAGG - Intergenic
1049958314 9:713348-713370 GCTGATGAGCTGAGAGTTGAGGG - Exonic
1051305962 9:15709905-15709927 AATGTTGATCTGAGTGATGAGGG - Intronic
1056742166 9:89266867-89266889 AATGGTAACCTGTGAGGTGATGG - Intergenic
1057170848 9:92962213-92962235 TGTGGTGACCTGAAAGGTGAGGG - Intronic
1057744039 9:97737509-97737531 AATGGTGAACTGAGAGGTTTTGG - Intergenic
1058775190 9:108276344-108276366 AATGATGACCTGAGAGTCAGCGG - Intergenic
1060260046 9:122066514-122066536 ACTGGTCACCTGAGAATTGCTGG + Intronic
1060398633 9:123334088-123334110 AAAACTGACCTGAGAGCTGAGGG + Intergenic
1061211464 9:129195853-129195875 AATGCTGTCCTGAGAGCTGGAGG - Intergenic
1061608328 9:131728769-131728791 AATGGTCACTTTAGAGTAGAAGG + Intronic
1062333196 9:136053509-136053531 AGTGGGGACCTGAGGGTGGAGGG - Intronic
1203431717 Un_GL000195v1:95753-95775 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1186435814 X:9542475-9542497 AATGGGGGCATCAGAGTTGAAGG + Intronic
1186444714 X:9617348-9617370 AATGGTCTCTTGAGAGTAGAAGG + Intronic
1187125261 X:16448505-16448527 AATGGTGACCTGAATGTATATGG + Intergenic
1187236030 X:17468393-17468415 AATGATGAGCTGAGAGTGAATGG - Intronic
1187316124 X:18196812-18196834 AAGGGTGACCTGAGAGAGGTGGG + Intronic
1190719466 X:53135435-53135457 ATTCGTGACCTCAGTGTTGAGGG - Intergenic
1190861871 X:54353028-54353050 AATGGTCACCTGGGACTTGGAGG + Intronic
1191068750 X:56378891-56378913 AATGTTACCCTGAAAGTTGAAGG + Intergenic
1191779359 X:64849364-64849386 AGAGGTGACCTGAGGGGTGATGG - Intergenic
1192193431 X:69012814-69012836 ATTGGTGTCCTGATGGTTGATGG - Intergenic
1193565788 X:83075441-83075463 AATGGTGTCTTGATATTTGATGG + Intergenic
1197715922 X:129705907-129705929 AATGGAGACCCCTGAGTTGAAGG - Intergenic
1198277082 X:135105128-135105150 AATGTTGACCGGAAAGTTGGAGG - Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic