ID: 985461863

View in Genome Browser
Species Human (GRCh38)
Location 4:190114936-190114958
Sequence AGGAAAACTACAGCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985461863_985461869 22 Left 985461863 4:190114936-190114958 CCCACAAAGGCTGTAGTTTTCCT No data
Right 985461869 4:190114981-190115003 AGGGTCTGGCTCTGTCACCCAGG 0: 511
1: 7349
2: 40032
3: 106791
4: 173072
985461863_985461870 26 Left 985461863 4:190114936-190114958 CCCACAAAGGCTGTAGTTTTCCT No data
Right 985461870 4:190114985-190115007 TCTGGCTCTGTCACCCAGGCTGG 0: 1990
1: 51987
2: 138461
3: 166166
4: 155611
985461863_985461866 2 Left 985461863 4:190114936-190114958 CCCACAAAGGCTGTAGTTTTCCT No data
Right 985461866 4:190114961-190114983 AAAAACATTTTTTTTGAGACAGG No data
985461863_985461868 8 Left 985461863 4:190114936-190114958 CCCACAAAGGCTGTAGTTTTCCT No data
Right 985461868 4:190114967-190114989 ATTTTTTTTGAGACAGGGTCTGG 0: 34
1: 623
2: 2762
3: 4716
4: 5507
985461863_985461867 3 Left 985461863 4:190114936-190114958 CCCACAAAGGCTGTAGTTTTCCT No data
Right 985461867 4:190114962-190114984 AAAACATTTTTTTTGAGACAGGG 0: 5
1: 138
2: 547
3: 1731
4: 6638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985461863 Original CRISPR AGGAAAACTACAGCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr