ID: 985462652

View in Genome Browser
Species Human (GRCh38)
Location 4:190121598-190121620
Sequence GACGGACGCCGCCGCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985462652_985462657 -2 Left 985462652 4:190121598-190121620 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462657 4:190121619-190121641 TCTCTGCGCCTGCGCGGCGGCGG No data
985462652_985462660 24 Left 985462652 4:190121598-190121620 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462660 4:190121645-190121667 CCGTCTCTGCGCCTGCGCCGCGG No data
985462652_985462661 27 Left 985462652 4:190121598-190121620 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462661 4:190121648-190121670 TCTCTGCGCCTGCGCCGCGGCGG No data
985462652_985462654 -8 Left 985462652 4:190121598-190121620 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462654 4:190121613-190121635 CGTCCGTCTCTGCGCCTGCGCGG No data
985462652_985462656 -5 Left 985462652 4:190121598-190121620 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462656 4:190121616-190121638 CCGTCTCTGCGCCTGCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985462652 Original CRISPR GACGGACGCCGCCGCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr