ID: 985462667

View in Genome Browser
Species Human (GRCh38)
Location 4:190121685-190121707
Sequence GACGGACGCCGCCGCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985462667_985462676 27 Left 985462667 4:190121685-190121707 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462676 4:190121735-190121757 TCTCTGCGCCTGCGCCGCGGCGG No data
985462667_985462670 -5 Left 985462667 4:190121685-190121707 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462670 4:190121703-190121725 CCGTCTCTGCGCCTGCGCCGCGG No data
985462667_985462675 24 Left 985462667 4:190121685-190121707 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462675 4:190121732-190121754 CCGTCTCTGCGCCTGCGCCGCGG No data
985462667_985462671 -2 Left 985462667 4:190121685-190121707 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462671 4:190121706-190121728 TCTCTGCGCCTGCGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985462667 Original CRISPR GACGGACGCCGCCGCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr