ID: 985462672

View in Genome Browser
Species Human (GRCh38)
Location 4:190121714-190121736
Sequence GACGGACGCCGCCGCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985462672_985462675 -5 Left 985462672 4:190121714-190121736 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462675 4:190121732-190121754 CCGTCTCTGCGCCTGCGCCGCGG No data
985462672_985462676 -2 Left 985462672 4:190121714-190121736 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462676 4:190121735-190121757 TCTCTGCGCCTGCGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985462672 Original CRISPR GACGGACGCCGCCGCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr