ID: 985462675

View in Genome Browser
Species Human (GRCh38)
Location 4:190121732-190121754
Sequence CCGTCTCTGCGCCTGCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985462669_985462675 6 Left 985462669 4:190121703-190121725 CCGTCTCTGCGCCTGCGCCGCGG No data
Right 985462675 4:190121732-190121754 CCGTCTCTGCGCCTGCGCCGCGG No data
985462667_985462675 24 Left 985462667 4:190121685-190121707 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462675 4:190121732-190121754 CCGTCTCTGCGCCTGCGCCGCGG No data
985462672_985462675 -5 Left 985462672 4:190121714-190121736 CCTGCGCCGCGGCGGCGTCCGTC No data
Right 985462675 4:190121732-190121754 CCGTCTCTGCGCCTGCGCCGCGG No data
985462668_985462675 18 Left 985462668 4:190121691-190121713 CCGCGGCGGCGTCCGTCTCTGCG No data
Right 985462675 4:190121732-190121754 CCGTCTCTGCGCCTGCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985462675 Original CRISPR CCGTCTCTGCGCCTGCGCCG CGG Intergenic
No off target data available for this crispr