ID: 985466789

View in Genome Browser
Species Human (GRCh38)
Location 4:190203974-190203996
Sequence CAAAGGCGGCGCGCCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985466789_985466796 14 Left 985466789 4:190203974-190203996 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 985466796 4:190204011-190204033 CGTTCTCTTTAGCACACACCTGG No data
985466789_985466798 29 Left 985466789 4:190203974-190203996 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 985466798 4:190204026-190204048 ACACCTGGAGAGCATCGCGAGGG No data
985466789_985466797 28 Left 985466789 4:190203974-190203996 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 985466797 4:190204025-190204047 CACACCTGGAGAGCATCGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985466789 Original CRISPR CAAAGGCGGCGCGCCGGCGC AGG (reversed) Intergenic