ID: 985467746

View in Genome Browser
Species Human (GRCh38)
Location 5:13191-13213
Sequence GCAATCTGAAAAGCCCGTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985467741_985467746 11 Left 985467741 5:13157-13179 CCAGCGGCGCGGCGTAGAGGAGG No data
Right 985467746 5:13191-13213 GCAATCTGAAAAGCCCGTTTCGG No data
985467740_985467746 12 Left 985467740 5:13156-13178 CCCAGCGGCGCGGCGTAGAGGAG No data
Right 985467746 5:13191-13213 GCAATCTGAAAAGCCCGTTTCGG No data
985467739_985467746 13 Left 985467739 5:13155-13177 CCCCAGCGGCGCGGCGTAGAGGA No data
Right 985467746 5:13191-13213 GCAATCTGAAAAGCCCGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985467746 Original CRISPR GCAATCTGAAAAGCCCGTTT CGG Intergenic
No off target data available for this crispr