ID: 985469188

View in Genome Browser
Species Human (GRCh38)
Location 5:27506-27528
Sequence AACTCACAAGGGTATTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985469188_985469195 20 Left 985469188 5:27506-27528 CCCAGTCAATACCCTTGTGAGTT No data
Right 985469195 5:27549-27571 CTTAATCCTATCAACCGAGGAGG No data
985469188_985469194 17 Left 985469188 5:27506-27528 CCCAGTCAATACCCTTGTGAGTT No data
Right 985469194 5:27546-27568 TCTCTTAATCCTATCAACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985469188 Original CRISPR AACTCACAAGGGTATTGACT GGG (reversed) Intergenic
No off target data available for this crispr