ID: 985472338

View in Genome Browser
Species Human (GRCh38)
Location 5:53809-53831
Sequence CAGTCCTGGACTCCGCGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985472320_985472338 25 Left 985472320 5:53761-53783 CCCAGGTAACCGCGCTGCGCCCG No data
Right 985472338 5:53809-53831 CAGTCCTGGACTCCGCGAGGGGG No data
985472330_985472338 5 Left 985472330 5:53781-53803 CCGGCGAGCAGATGGGGGGTAGT No data
Right 985472338 5:53809-53831 CAGTCCTGGACTCCGCGAGGGGG No data
985472321_985472338 24 Left 985472321 5:53762-53784 CCAGGTAACCGCGCTGCGCCCGG No data
Right 985472338 5:53809-53831 CAGTCCTGGACTCCGCGAGGGGG No data
985472323_985472338 16 Left 985472323 5:53770-53792 CCGCGCTGCGCCCGGCGAGCAGA No data
Right 985472338 5:53809-53831 CAGTCCTGGACTCCGCGAGGGGG No data
985472329_985472338 6 Left 985472329 5:53780-53802 CCCGGCGAGCAGATGGGGGGTAG No data
Right 985472338 5:53809-53831 CAGTCCTGGACTCCGCGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985472338 Original CRISPR CAGTCCTGGACTCCGCGAGG GGG Intergenic
No off target data available for this crispr