ID: 985478018

View in Genome Browser
Species Human (GRCh38)
Location 5:90841-90863
Sequence GGGCAGTACTGTCACGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985478014_985478018 -4 Left 985478014 5:90822-90844 CCATCCTGGACAGCACCGTGGGC No data
Right 985478018 5:90841-90863 GGGCAGTACTGTCACGAGGACGG No data
985478009_985478018 21 Left 985478009 5:90797-90819 CCACACAGGCTTAGAAAGGTGGC No data
Right 985478018 5:90841-90863 GGGCAGTACTGTCACGAGGACGG No data
985478012_985478018 -3 Left 985478012 5:90821-90843 CCCATCCTGGACAGCACCGTGGG No data
Right 985478018 5:90841-90863 GGGCAGTACTGTCACGAGGACGG No data
985478015_985478018 -8 Left 985478015 5:90826-90848 CCTGGACAGCACCGTGGGCAGTA No data
Right 985478018 5:90841-90863 GGGCAGTACTGTCACGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985478018 Original CRISPR GGGCAGTACTGTCACGAGGA CGG Intergenic
No off target data available for this crispr