ID: 985478277

View in Genome Browser
Species Human (GRCh38)
Location 5:91966-91988
Sequence GCCACTGCCGCCCGCGCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985478274_985478277 -3 Left 985478274 5:91946-91968 CCGAGAGAACAAAAGCAGAAGCC No data
Right 985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG No data
985478271_985478277 12 Left 985478271 5:91931-91953 CCCGAGCTCCGGGCTCCGAGAGA No data
Right 985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG No data
985478267_985478277 29 Left 985478267 5:91914-91936 CCACAAAATGGCAGGTCCCCGAG No data
Right 985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG No data
985478273_985478277 4 Left 985478273 5:91939-91961 CCGGGCTCCGAGAGAACAAAAGC No data
Right 985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG No data
985478272_985478277 11 Left 985478272 5:91932-91954 CCGAGCTCCGGGCTCCGAGAGAA No data
Right 985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG No data
985478270_985478277 13 Left 985478270 5:91930-91952 CCCCGAGCTCCGGGCTCCGAGAG No data
Right 985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985478277 Original CRISPR GCCACTGCCGCCCGCGCTCG GGG Intergenic
No off target data available for this crispr