ID: 985480585

View in Genome Browser
Species Human (GRCh38)
Location 5:107844-107866
Sequence TGCAGTGATCCGGGTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985480577_985480585 -9 Left 985480577 5:107830-107852 CCACTAGCTCCCAATGCAGTGAT No data
Right 985480585 5:107844-107866 TGCAGTGATCCGGGTGGGGCTGG No data
985480574_985480585 0 Left 985480574 5:107821-107843 CCACCTGGCCCACTAGCTCCCAA No data
Right 985480585 5:107844-107866 TGCAGTGATCCGGGTGGGGCTGG No data
985480575_985480585 -3 Left 985480575 5:107824-107846 CCTGGCCCACTAGCTCCCAATGC No data
Right 985480585 5:107844-107866 TGCAGTGATCCGGGTGGGGCTGG No data
985480576_985480585 -8 Left 985480576 5:107829-107851 CCCACTAGCTCCCAATGCAGTGA No data
Right 985480585 5:107844-107866 TGCAGTGATCCGGGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985480585 Original CRISPR TGCAGTGATCCGGGTGGGGC TGG Intergenic
No off target data available for this crispr