ID: 985481042

View in Genome Browser
Species Human (GRCh38)
Location 5:111105-111127
Sequence CCAAAGGTGCTCCCCAGAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985481033_985481042 29 Left 985481033 5:111053-111075 CCTGCACACACACTGCAGCTCCC No data
Right 985481042 5:111105-111127 CCAAAGGTGCTCCCCAGAATCGG No data
985481035_985481042 8 Left 985481035 5:111074-111096 CCTCATCATGAGCAGTCATCTAG No data
Right 985481042 5:111105-111127 CCAAAGGTGCTCCCCAGAATCGG No data
985481034_985481042 9 Left 985481034 5:111073-111095 CCCTCATCATGAGCAGTCATCTA No data
Right 985481042 5:111105-111127 CCAAAGGTGCTCCCCAGAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985481042 Original CRISPR CCAAAGGTGCTCCCCAGAAT CGG Intergenic
No off target data available for this crispr