ID: 985484759

View in Genome Browser
Species Human (GRCh38)
Location 5:141848-141870
Sequence AGGCTGAGCCCTCCTTTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985484751_985484759 13 Left 985484751 5:141812-141834 CCAGCAAGTAGGGCCACCCAACC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 985484759 5:141848-141870 AGGCTGAGCCCTCCTTTCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 175
985484755_985484759 -3 Left 985484755 5:141828-141850 CCCAACCTCGGGAAAGTGACAGG 0: 1
1: 0
2: 1
3: 4
4: 94
Right 985484759 5:141848-141870 AGGCTGAGCCCTCCTTTCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 175
985484757_985484759 -4 Left 985484757 5:141829-141851 CCAACCTCGGGAAAGTGACAGGC 0: 1
1: 0
2: 1
3: 4
4: 89
Right 985484759 5:141848-141870 AGGCTGAGCCCTCCTTTCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 175
985484754_985484759 0 Left 985484754 5:141825-141847 CCACCCAACCTCGGGAAAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 985484759 5:141848-141870 AGGCTGAGCCCTCCTTTCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 175
985484758_985484759 -8 Left 985484758 5:141833-141855 CCTCGGGAAAGTGACAGGCTGAG 0: 1
1: 0
2: 0
3: 16
4: 156
Right 985484759 5:141848-141870 AGGCTGAGCCCTCCTTTCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985484759 Original CRISPR AGGCTGAGCCCTCCTTTCCG TGG Intronic
900949121 1:5847690-5847712 ATGCTGAGACCTCATCTCCGGGG + Intergenic
901668034 1:10837478-10837500 AGGCTGGCCCCTCCCCTCCGTGG - Intergenic
902917039 1:19645246-19645268 AGGGAGAGCCAGCCTTTCCGGGG + Intronic
904697117 1:32336768-32336790 AGGCAGAGCCCTCCGCTCCCCGG - Intergenic
904941527 1:34167105-34167127 AGGCTGAGCCCTCTCTTTCGGGG - Intronic
906032356 1:42731915-42731937 AGTCTGAGCCCTACCTTCCTGGG + Intergenic
906100638 1:43258261-43258283 AGGCTGAGCTCTCATCTCCTTGG - Intronic
906523026 1:46478436-46478458 AGGCAGTGCCTTCCTTCCCGAGG - Intergenic
912514513 1:110209845-110209867 AGGCTGCCCTCTCCTTTCCCAGG - Intergenic
913112793 1:115671348-115671370 AGCCTGCGGCCTCCTTTCCCTGG + Intronic
913450286 1:118988301-118988323 AGGCGGTGCGCTCCTGTCCGAGG + Intronic
913665573 1:121045222-121045244 AGGCTGAGCTTACCTTTCCAAGG + Intergenic
914016971 1:143828492-143828514 AGGCTGAGCTTACCTTTCCAAGG + Intergenic
914160814 1:145132506-145132528 AGGCTGAGCTTACCTTTCCAAGG - Intergenic
914655580 1:149737034-149737056 AGGCTGAGCTTACCTTTCCAAGG + Intergenic
922214461 1:223509205-223509227 AGGCAGATCCCACCTTTCCAGGG + Intergenic
1062847932 10:722343-722365 AGGCTGAGCCGTGCTTCCCCAGG - Intergenic
1063295357 10:4799878-4799900 AGACTCATCCCTCCTTTCCAAGG - Intronic
1066623308 10:37380811-37380833 AGGCTGAGCCCTGCTGCCCCTGG - Intronic
1067980941 10:51083571-51083593 AGGCTGAGGAGTACTTTCCGAGG + Intronic
1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG + Intronic
1069554279 10:69386992-69387014 AGGCTGTGCCCACCTGTCAGGGG - Intronic
1071229149 10:83564841-83564863 AGGCTCAGTGCTCCTCTCCGCGG - Intergenic
1075093371 10:119455793-119455815 AGGCTGAGCCCTTCTCCTCGAGG + Intronic
1075424805 10:122333199-122333221 AGGCTGAGCCAGCCTCTCCAGGG - Intronic
1075501682 10:122980522-122980544 ACGCAGAGGCCTCGTTTCCGCGG - Exonic
1076829104 10:132985446-132985468 AGGCTGACCCCTCCTTTCTTCGG + Intergenic
1077032467 11:474649-474671 AGCCTGAGCCCGCCTTCCTGGGG - Intronic
1078007492 11:7543415-7543437 TGGCTGAGGCCTCCTTCCCCAGG + Intronic
1078339315 11:10487633-10487655 AGGCTGTGCCCTATTTTCCAAGG - Intronic
1078605872 11:12775185-12775207 GAGCTGAGCCCTCCTTTCTTAGG + Intronic
1082750024 11:57005443-57005465 AGGCTGTGCCTTCCTTTATGGGG - Intergenic
1083033583 11:59615790-59615812 CGGCCGAGCCCTCCTCCCCGCGG - Exonic
1084271828 11:68033179-68033201 CCGCTGAGCCCTCGCTTCCGTGG + Exonic
1084564274 11:69920512-69920534 AGGCTGAGTCCTCCCTCCTGGGG + Intergenic
1084762894 11:71285140-71285162 AGGCTGAGCCCTCCCTGCCCTGG - Intergenic
1085921039 11:80957387-80957409 GAGCTGAGCCCTCCTTGCCTTGG - Intergenic
1088561581 11:111120869-111120891 AGCCTGAGCTCTCCTGTCCTTGG - Intergenic
1090858442 11:130631933-130631955 TGGCTGATCCCTACTTTCCATGG + Intergenic
1091290474 11:134436721-134436743 AGGCTGAGCCCAGCCTTCCTCGG + Intergenic
1091670565 12:2449363-2449385 AGCCTGACCCCTCCTTTTCCTGG - Intronic
1096676188 12:53227403-53227425 ATGCTGAGCCCTAGCTTCCGGGG - Exonic
1101861553 12:108486393-108486415 AGGCTGAGGCCGCCTTTCATAGG + Intergenic
1102497729 12:113330992-113331014 AGGCTGTGCCCTCCCTGCCCTGG + Intronic
1102755420 12:115335609-115335631 AGGCTGAGCCCACAATTCCTCGG - Intergenic
1103344854 12:120242397-120242419 AGGCTGACCCCTCTTTTTCCTGG - Intronic
1104071729 12:125351745-125351767 AGGCTGTGCCCTCTTCTCAGGGG - Intronic
1104418933 12:128619336-128619358 TGGCTGAATCCTCCTATCCGTGG - Intronic
1104772026 12:131369466-131369488 GAGCTGAGCTCTTCTTTCCGGGG + Intergenic
1107354133 13:39547661-39547683 TGGCTGAGCCCTTCTGTCTGAGG - Intronic
1107456022 13:40555295-40555317 AGGATCAGCCCTCCTTTAAGTGG - Intergenic
1108888563 13:55223647-55223669 AATCTGATCCCTCCTTTCCTTGG + Intergenic
1112484924 13:99811342-99811364 TGGCTGAGGCCTCCCTTCCCAGG - Intronic
1112988426 13:105480888-105480910 AGGAAGATCCCTCCTTACCGTGG - Intronic
1113507193 13:110825504-110825526 AGGCTGAGCCCACAGCTCCGGGG + Intergenic
1114536282 14:23425035-23425057 AGGCTCAGCACTCCTTTCAATGG - Intronic
1117546022 14:56795245-56795267 AGGTTGAGGCCTCCTTCGCGGGG - Intergenic
1118593134 14:67416287-67416309 AGGCTGAGCCCTGCTACCTGGGG + Intergenic
1118837000 14:69484707-69484729 AGGCTGAGCCACCCTCCCCGCGG + Intronic
1122083803 14:99285631-99285653 ATGCAAAGCCCTCCTTTCTGTGG + Intergenic
1123034833 14:105467658-105467680 AGCCCCAGCCCTCCTTTCCTGGG + Intronic
1124625467 15:31305108-31305130 TGGCTGAGGCCTCCATTCCCCGG + Intergenic
1128113849 15:65093432-65093454 AGGCTGGGGCCTTCTTTCCTTGG - Intronic
1128498323 15:68210679-68210701 AGGCTGAGACCACATTTCTGAGG + Intronic
1130196190 15:81782324-81782346 AGCCTGAGCCCAACTTTCTGGGG + Intergenic
1130693087 15:86103747-86103769 AGGCTGAGCATGCCTTTCCTTGG + Intergenic
1134112947 16:11527252-11527274 AAGCTGAGCCCTCCTCTTTGGGG - Intergenic
1135920149 16:26642380-26642402 AATCTGAGCCCTCCTTTCAAAGG - Intergenic
1139505798 16:67397549-67397571 AGGCTGAGCCCTGGATCCCGAGG - Intronic
1140484434 16:75282624-75282646 GGGCAGAGCCCTCCTCTCCCAGG - Intergenic
1141068089 16:80930116-80930138 AGGCTGGCACCTCCTTTCCCCGG + Intergenic
1141813822 16:86395639-86395661 ACGCTGAGGCATCCTTTCCATGG - Intergenic
1141855244 16:86676818-86676840 AGACTGAGCTCTCCTCTCCTTGG - Intergenic
1142200128 16:88757193-88757215 AGGCTGAGCCCTCGGAGCCGGGG + Intronic
1144462412 17:15468778-15468800 AGGCAGAGCCCTCATTGCTGCGG + Intronic
1146534790 17:33640798-33640820 AGGCTGAGCCCTGCTGCCCCTGG + Intronic
1148742425 17:49900381-49900403 GGGCTGAGGCCACCTTTCAGGGG - Intergenic
1148742585 17:49901354-49901376 AGGCTGAGCTCTCCTTCTGGGGG + Intergenic
1151735231 17:75935786-75935808 AGGCTTAGCTCTCCTTTCATTGG + Intronic
1152554231 17:81045168-81045190 AGTCTGAGCCCTCCTGAACGAGG - Intronic
1152875285 17:82782977-82782999 CCGCTGTGCCCTCCTGTCCGCGG + Intronic
1153777282 18:8465206-8465228 AGGCCTGGCCCTCCTTTCAGAGG - Intergenic
1153985965 18:10351061-10351083 ATGCTGACCCCTCCTCTCCGAGG - Intergenic
1154072342 18:11163949-11163971 AGGCTGAGCACTCCTTGGAGGGG + Intergenic
1159146712 18:64463733-64463755 AGACTGAGTCCTCTTTTCCAGGG + Intergenic
1159409449 18:68052709-68052731 AGGCAGAGCCCTCCTTATAGTGG - Intergenic
1162373229 19:10291045-10291067 AGGCTCAGCCCGCGTTTCCCTGG + Intronic
1162638320 19:11987620-11987642 ATGCTGCGCCCTCCTTCCGGCGG - Intergenic
1164698187 19:30262562-30262584 CGGATGAGCCCTCCCTTCCTGGG - Intronic
925966546 2:9072030-9072052 AGCCTGAGCTCTCCTTTCCCTGG - Intergenic
926357686 2:12056416-12056438 AGGCTGAGCCCCACCTTCTGAGG + Intergenic
927138841 2:20116001-20116023 AGCCTCAGCCCTCCTTTTGGGGG - Intergenic
927198345 2:20563416-20563438 AGGCTGGGCCCTCATTGCTGGGG - Intronic
929712905 2:44282512-44282534 AGCCAGATCCCTCCTTTCTGGGG + Intronic
935528458 2:104202353-104202375 TGGCTGAGCCTTCCTTTGCTGGG + Intergenic
938296437 2:130182251-130182273 GGGCGGAGCGCACCTTTCCGCGG + Exonic
938376002 2:130807171-130807193 AGGCTGAGGTCACCTTTCCCAGG + Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
946757254 2:222960049-222960071 AGGCTCAGTCCTCTTTTCCCAGG + Intergenic
948708513 2:239810709-239810731 AGGCTGACCCCTCCATCCCATGG + Intergenic
949018327 2:241726036-241726058 AGCCGGAGCCATCCTTTCGGTGG + Exonic
1168842090 20:916041-916063 AGTCTGAGCCCTGCCCTCCGGGG - Exonic
1169038194 20:2470670-2470692 AGCCTGTGCCCTCCTTACCATGG + Exonic
1170605686 20:17873803-17873825 AGGCTGCGCCATCCCTTCCAGGG - Intergenic
1174393641 20:50233252-50233274 GGGCTGAGGCCTCCTCTCCTGGG + Intergenic
1177759592 21:25388458-25388480 AGGCTGACCCCTCCTCTTCCCGG - Intergenic
1178721510 21:35014755-35014777 GGGCTGAGCCCTCTCTGCCGAGG + Intronic
1179580247 21:42338847-42338869 AGGCTCAGGCATCCTTGCCGTGG + Intergenic
1181637129 22:24179734-24179756 TGGCTGAACCCGCCTTTCGGGGG + Intergenic
1183465809 22:37979948-37979970 AGGCCGAGCCCTCCCTCCCCAGG + Intronic
1185210292 22:49566883-49566905 ATGGTAAGCCCTGCTTTCCGGGG + Intronic
949478053 3:4467281-4467303 TGGCTGAGCCCTCCTTAAAGGGG + Exonic
951674533 3:25222006-25222028 AGACGGAGCCCTCCTTTCATGGG + Intronic
953906998 3:46873401-46873423 AAGCTCAGCCCTGCCTTCCGTGG - Intronic
956249577 3:67221540-67221562 AGACTCAGCCCTCCTTGCAGAGG + Intergenic
961012424 3:123445349-123445371 AGGCTCAGCACCCCTTTCCTGGG + Intronic
962973725 3:140428082-140428104 CTGCTGAGCCCTCCTTACAGGGG + Intronic
963123697 3:141796696-141796718 AGGCTGAGGCATACTTTCCACGG - Intronic
966850746 3:184163722-184163744 AGGCTGAGGGCTCCTTACCCAGG - Exonic
967106750 3:186260638-186260660 AGGCAGTGCCCTCCCCTCCGGGG - Intronic
967139462 3:186542268-186542290 AGACTAAGCTCTCCTTTCAGTGG + Intronic
968517199 4:1020421-1020443 ACGCAGGGCCCTCCTTTCCCAGG + Intronic
968758225 4:2427721-2427743 AGTCTGAGCCCACCTTCCCTTGG + Intronic
969517852 4:7658488-7658510 GGCCTGAGACCTCCTTTCCAAGG + Intronic
970263431 4:14254329-14254351 TGGCCGAGCCTTCCTTGCCGTGG - Intergenic
978806383 4:112805141-112805163 CAGCCCAGCCCTCCTTTCCGTGG - Intergenic
980610841 4:135161235-135161257 ATGCAGAGCCCTCCTTTTCAGGG + Intergenic
983728267 4:170958054-170958076 AGGATGAGCCCTCCTGGCCATGG + Intergenic
985484759 5:141848-141870 AGGCTGAGCCCTCCTTTCCGTGG + Intronic
986317966 5:6603812-6603834 AGGCTGACCCCTCCTCTCCCCGG + Intronic
986720458 5:10557392-10557414 ACCCTGAGCCCTCCTTCCCTGGG - Intergenic
994578536 5:101610955-101610977 TGGCTGAGCCCAGCTTGCCGCGG + Intergenic
995896860 5:117023040-117023062 AGGCAGTGCTCTCCATTCCGTGG + Intergenic
998265107 5:140662096-140662118 AGGCTGACCTCTCATTTCCATGG - Intronic
999056886 5:148587525-148587547 GGGCTGAGCCCACCTTTCTCAGG + Intronic
1000351452 5:160355977-160355999 AGCCTGTGCCCTCCTGTCCCAGG + Intronic
1005317920 6:24622093-24622115 AGGCAGAGCTCTCCTTCCAGTGG + Intronic
1007435211 6:41805803-41805825 AGCCTGATCCCTGCCTTCCGCGG - Exonic
1007595902 6:43051142-43051164 AGGCTCAGCCCTCCTTCAGGAGG - Exonic
1008761493 6:54857431-54857453 AGACTGAACCCTGCTTCCCGTGG + Intronic
1015210779 6:130695867-130695889 AGGCAGGGCCTTCCTTTCCAAGG - Intergenic
1017743972 6:157430474-157430496 AGGCTGCCCCCGCCTTTCCCTGG + Intronic
1018008834 6:159649203-159649225 AGGCAGAGCCATCATTTCCCAGG + Intergenic
1019625521 7:2013947-2013969 AGGCTGAGGCCACCTCTCCTGGG + Intronic
1019913415 7:4115596-4115618 AGCATGAGTCCTCCTTTCCTTGG + Intronic
1020142889 7:5622171-5622193 AGGCTGAGAAATCCTTTCCCAGG - Intronic
1024608943 7:51046439-51046461 TTTCTGATCCCTCCTTTCCGAGG + Intronic
1025704948 7:63854750-63854772 AAACTGAGCCCTCCCTTCTGGGG - Intergenic
1026584661 7:71646645-71646667 AGGCTGAACCCTCCTATGCTTGG + Intronic
1026740367 7:72975334-72975356 AGGCTGGGACCTCCTTCCCTAGG + Intergenic
1026911154 7:74092707-74092729 ATGCTCAGCCCTCCTTGCCCAGG - Intronic
1027103364 7:75389736-75389758 AGGCTGGGACCTCCTTCCCTAGG - Intergenic
1027666768 7:81049661-81049683 AGGCTGAGCCCCCGTCTCCTGGG + Intergenic
1028267818 7:88749466-88749488 AAGCTGAGCCCTCTTCCCCGGGG - Intergenic
1029422597 7:100478912-100478934 AGGCTGTCCCGTCCTCTCCGGGG + Exonic
1030820574 7:114086748-114086770 AGGCAGCGCCCTGCTTGCCGGGG + Intronic
1033237981 7:139653494-139653516 AGGCAGAGGCCTCCTTCCCGAGG - Intronic
1034332094 7:150291826-150291848 AGTCTCAGCACTCCTTTCGGTGG - Intronic
1034447408 7:151120691-151120713 AGGCTTAGCCATCTTTTCCTGGG + Intronic
1034482700 7:151335001-151335023 ATGCTGAGCCCACCTTTGGGTGG - Intergenic
1034665941 7:152818047-152818069 AGTCTCAGCACTCCTTTCTGTGG + Intronic
1035459147 7:159028746-159028768 ATGCTCAGCCGTCCTTTCCTGGG + Exonic
1037623801 8:20590352-20590374 AGCCTGGCCCCTCCTTTCCTAGG + Intergenic
1037881800 8:22577127-22577149 GGGCTGAGGCCTCCTCTCCCTGG + Intergenic
1040841218 8:51786883-51786905 AGGCTGAACTCTCCTATCAGGGG + Intronic
1048572743 8:135668911-135668933 AGGCTGTGCCCCCTTTTCTGGGG + Intergenic
1049023765 8:139974806-139974828 AGGCTGGGCCCAGGTTTCCGTGG + Intronic
1049341178 8:142113457-142113479 GGGCTGAGGGCTACTTTCCGTGG + Intergenic
1049368186 8:142250966-142250988 AGGCTGAGCCGCCCTTACGGGGG - Intronic
1052769674 9:32676190-32676212 ATGATGGGCCCTCCTTTCCGTGG - Intergenic
1053072869 9:35111399-35111421 AGGCTGAGCCCTGCTCTGCTAGG + Exonic
1056623737 9:88236944-88236966 GTGATGAGCTCTCCTTTCCGGGG - Intergenic
1062214605 9:135382446-135382468 GGGCTGAGTCCACCTCTCCGTGG + Intergenic
1189465622 X:41275981-41276003 AGGCTGATCCGCCTTTTCCGTGG - Intergenic
1189866160 X:45329399-45329421 AGCCTGAGCACTCCTTCCCTTGG - Intergenic
1190598516 X:52068183-52068205 AGGCTGAGCTCTCATCTCCCTGG - Exonic
1190610308 X:52185890-52185912 AGGCTGAGCTCTCATCTCCCTGG + Exonic
1192561258 X:72129613-72129635 TTGCTGATCCCTCCTTTCCCAGG + Exonic
1195688936 X:107608391-107608413 AGCCTGACCCCACCTTTCTGTGG + Intergenic
1197785183 X:130191261-130191283 AAGCTGAGCCTTGCTTTCCAGGG - Intergenic
1197902941 X:131392993-131393015 AAGCTGAGCCTTGCTTTCCAGGG - Intronic
1199684442 X:150254094-150254116 CGGCTGTGCCCTCCCTTCTGTGG - Intergenic
1199948935 X:152690054-152690076 AGGCTGTGCCCTACTTCCAGTGG + Intergenic
1199960741 X:152778395-152778417 AGGCTGTGCCCTACTTCCAGTGG - Intergenic