ID: 985485831

View in Genome Browser
Species Human (GRCh38)
Location 5:147949-147971
Sequence CAGTGTAAACAGAATGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 353}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985485827_985485831 15 Left 985485827 5:147911-147933 CCTGGAATGCAAGGATGGTTCGA 0: 3
1: 95
2: 1140
3: 11930
4: 7979
Right 985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985485831 Original CRISPR CAGTGTAAACAGAATGAAGG GGG Intronic
900764789 1:4497463-4497485 CAGTGGAAACAGAATCAAGTTGG - Intergenic
901748822 1:11393293-11393315 CATTCTAAACAGCAGGAAGGAGG - Intergenic
902825409 1:18970129-18970151 CAGTGTCAAGTGACTGAAGGAGG + Intergenic
903977372 1:27159677-27159699 CAGTGTAAAAAGAAGAAAAGAGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906658856 1:47568296-47568318 CAGTATAAGCATAATGTAGGAGG - Intergenic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
908814086 1:68013815-68013837 CAGTCAAAAGAGAGTGAAGGGGG - Intergenic
909839791 1:80305669-80305691 CAGTGGAAGCAGAATGCAAGAGG + Intergenic
910267773 1:85357769-85357791 CAGTATAACCAGAATGAATTTGG + Intronic
912398145 1:109364940-109364962 CATTGCAAACAGAATGAACTTGG - Intronic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
912552463 1:110492994-110493016 AAGTGTAAAAATAATGAAAGTGG - Intergenic
913605646 1:120463278-120463300 CACTGAAATTAGAATGAAGGAGG - Intergenic
913643064 1:120830900-120830922 CACTGAAATTAGAATGAAGGAGG - Intronic
913643831 1:120837653-120837675 CACTGAAATTAGAATGAAGGAGG - Intronic
914082900 1:144425944-144425966 CACTGAAATTAGAATGAAGGAGG + Intronic
914177817 1:145294448-145294470 CACTGAAATTAGAATGAAGGAGG + Intronic
914178362 1:145299214-145299236 CACTGAAATTAGAATGAAGGAGG + Intronic
914178907 1:145303960-145303982 CACTGAAATTAGAATGAAGGAGG + Intronic
914179285 1:145307143-145307165 CACTGAAATTAGAATGAAGGAGG + Intronic
914179660 1:145310324-145310346 CACTGAAATTAGAATGAAGGAGG + Intronic
914180205 1:145315092-145315114 CACTGAAATTAGAATGAAGGAGG + Intronic
914180750 1:145319862-145319884 CACTGAAATTAGAATGAAGGAGG + Intronic
914181293 1:145324612-145324634 CACTGAAATTAGAATGAAGGAGG + Intronic
914181836 1:145329372-145329394 CACTGAAATTAGAATGAAGGAGG + Intronic
914182381 1:145334125-145334147 CACTGAAATTAGAATGAAGGAGG + Intronic
914182926 1:145338881-145338903 CACTGAAATTAGAATGAAGGAGG + Intronic
914183471 1:145343635-145343657 CACTGAAATTAGAATGAAGGAGG + Intronic
914184015 1:145348405-145348427 CACTGAAATTAGAATGAAGGAGG + Intronic
914184559 1:145353169-145353191 CACTGAAATTAGAATGAAGGAGG + Intronic
914185103 1:145357917-145357939 CACTGAAATTAGAATGAAGGAGG + Intronic
914185648 1:145362670-145362692 CACTGAAATTAGAATGAAGGAGG + Intronic
914186194 1:145367430-145367452 CACTGAAATTAGAATGAAGGAGG + Intronic
914186740 1:145372178-145372200 CACTGAAATTAGAATGAAGGAGG + Intronic
914187284 1:145376932-145376954 CACTGAAATTAGAATGAAGGAGG + Intronic
914187827 1:145381684-145381706 CACTGAAATTAGAATGAAGGAGG + Intronic
914188372 1:145386440-145386462 CACTGAAATTAGAATGAAGGAGG + Intronic
914188915 1:145391196-145391218 CACTGAAATTAGAATGAAGGAGG + Intronic
914210768 1:145576887-145576909 CACTGAAATTAGAATGAAGGAGG + Intergenic
914270067 1:146072395-146072417 CACTGAAATTAGAATGAAGGAGG + Intronic
914270606 1:146077133-146077155 CACTGAAATTAGAATGAAGGAGG + Intronic
914271144 1:146081863-146081885 CACTGAAATTAGAATGAAGGAGG + Intronic
914271680 1:146086591-146086613 CACTGAAATTAGAATGAAGGAGG + Intronic
914272215 1:146091308-146091330 CACTGAAATTAGAATGAAGGAGG + Intronic
914272753 1:146096030-146096052 CACTGAAATTAGAATGAAGGAGG + Intronic
914273291 1:146100752-146100774 CACTGAAATTAGAATGAAGGAGG + Intronic
914273830 1:146105470-146105492 CACTGAAATTAGAATGAAGGAGG + Intronic
914274366 1:146110178-146110200 CACTGAAATTAGAATGAAGGAGG + Intronic
914274902 1:146114896-146114918 CACTGAAATTAGAATGAAGGAGG + Intronic
914275436 1:146119622-146119644 CACTGAAATTAGAATGAAGGAGG + Intronic
914275973 1:146124354-146124376 CACTGAAATTAGAATGAAGGAGG + Intronic
914366855 1:146986836-146986858 CACTGAAATTAGAATGAAGGAGG - Intronic
914367391 1:146991597-146991619 CACTGAAATTAGAATGAAGGAGG - Intronic
914380657 1:147113110-147113132 CACTGAAATTAGAATGAAGGAGG + Intergenic
914532906 1:148539076-148539098 CACTGAAATTAGAATGAAGGAGG + Intronic
914533440 1:148543790-148543812 CACTGAAATTAGAATGAAGGAGG + Intronic
914533975 1:148548498-148548520 CACTGAAATTAGAATGAAGGAGG + Intronic
914534511 1:148553206-148553228 CACTGAAATTAGAATGAAGGAGG + Intronic
914535046 1:148557918-148557940 CACTGAAATTAGAATGAAGGAGG + Intronic
914535581 1:148562663-148562685 CACTGAAATTAGAATGAAGGAGG + Intronic
914536117 1:148567379-148567401 CACTGAAATTAGAATGAAGGAGG + Intronic
914536651 1:148572109-148572131 CACTGAAATTAGAATGAAGGAGG + Intronic
914537012 1:148575305-148575327 CACTGAAATTAGAATGAAGGAGG + Intronic
914585558 1:149058591-149058613 CACTGAAATTAGAATGAAGGAGG + Intronic
914585923 1:149061759-149061781 CACTGAAATTAGAATGAAGGAGG + Intronic
914628911 1:149490045-149490067 CACTGAAATTAGAATGAAGGAGG - Intergenic
914629445 1:149494802-149494824 CACTGAAATTAGAATGAAGGAGG - Intergenic
914629979 1:149499557-149499579 CACTGAAATTAGAATGAAGGAGG - Intergenic
914630513 1:149504318-149504340 CACTGAAATTAGAATGAAGGAGG - Intergenic
914631046 1:149509079-149509101 CACTGAAATTAGAATGAAGGAGG - Intergenic
914631578 1:149513840-149513862 CACTGAAATTAGAATGAAGGAGG - Intergenic
914632113 1:149518594-149518616 CACTGAAATTAGAATGAAGGAGG - Intergenic
914632650 1:149523349-149523371 CACTGAAATTAGAATGAAGGAGG - Intergenic
914633185 1:149528098-149528120 CACTGAAATTAGAATGAAGGAGG - Intergenic
914633720 1:149532829-149532851 CACTGAAATTAGAATGAAGGAGG - Intergenic
914634256 1:149537584-149537606 CACTGAAATTAGAATGAAGGAGG - Intergenic
914634790 1:149542337-149542359 CACTGAAATTAGAATGAAGGAGG - Intergenic
914635325 1:149547074-149547096 CACTGAAATTAGAATGAAGGAGG - Intergenic
914635860 1:149551811-149551833 CACTGAAATTAGAATGAAGGAGG - Intergenic
914883552 1:151566426-151566448 CACTGTTAACAGATTGAAGTGGG + Intronic
916798945 1:168195942-168195964 CAGTGGAGAAAGTATGAAGGTGG - Intronic
917869783 1:179230568-179230590 CAGTCTAAAGAGAGTGAATGAGG + Intergenic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
919604200 1:199660674-199660696 CAGTGTAAACTCAAAGAATGGGG - Intergenic
920152042 1:203918484-203918506 CCATGAAAACATAATGAAGGTGG - Intergenic
922197973 1:223376183-223376205 CAGTGTAAACAGATTTAAGATGG - Intergenic
922736889 1:227990241-227990263 CCATATCAACAGAATGAAGGGGG + Intergenic
1063284258 10:4666087-4666109 CATAGGAAAAAGAATGAAGGTGG - Intergenic
1065765864 10:29028820-29028842 CAGTAGAGACAGAGTGAAGGGGG + Intergenic
1066448400 10:35505290-35505312 ATGTGAAAACAGAATGAATGAGG + Intronic
1067995131 10:51263557-51263579 CACTGTAAACAAAAACAAGGAGG + Intronic
1070206561 10:74269215-74269237 CAGTTTAAAAACAATTAAGGAGG - Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1071002727 10:80848881-80848903 CTGTGTAAAAAGAATAAAGCTGG + Intergenic
1071055182 10:81501913-81501935 AAGTGTAAAAAAAATGAAGTGGG - Intergenic
1071860808 10:89670702-89670724 CAGTCCTAACAGAATCAAGGTGG - Intergenic
1072971320 10:100020185-100020207 GTATGTGAACAGAATGAAGGTGG + Intergenic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1074910846 10:117906909-117906931 AAGTATAAACAGAATGATGGAGG + Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1077809051 11:5619311-5619333 CTCTGGCAACAGAATGAAGGAGG - Intronic
1077995481 11:7448943-7448965 TAGTCTTCACAGAATGAAGGAGG + Intronic
1079538656 11:21545701-21545723 GAGTGAAAACAGAATGAGAGGGG + Intronic
1079670942 11:23170222-23170244 CAGTGTTGACAAAATGTAGGGGG - Intergenic
1081012203 11:37827527-37827549 CTGCCTACACAGAATGAAGGAGG - Intergenic
1081604258 11:44517551-44517573 GTGTGTAAAGAGAATGGAGGAGG + Intergenic
1082108372 11:48244648-48244670 CAGTGGAAACAGATTAGAGGAGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083715431 11:64572509-64572531 CAGTGTACACAGGGTGAAAGAGG - Exonic
1085163091 11:74367154-74367176 CAGAGATAACAGACTGAAGGAGG + Intronic
1085231501 11:74975153-74975175 TAATGTGAACAGAATGAAGTGGG - Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1086737327 11:90322504-90322526 CTCTGTAAACAAAATGCAGGGGG - Intergenic
1086986101 11:93251083-93251105 CAGTGAACACACAATGAACGAGG - Intergenic
1090898724 11:131005766-131005788 CAGTGTGAACAGAATCACGTAGG + Intergenic
1091175343 11:133552909-133552931 CAGTCTTAAAAGCATGAAGGAGG + Intergenic
1092322851 12:7496860-7496882 CAATGTAAACACCATGAATGGGG - Exonic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093028672 12:14267998-14268020 CAGTGATAAAAGAATGGAGGCGG - Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1093997517 12:25657797-25657819 CAGAGTAAAGAGAATTAACGGGG + Intergenic
1095360581 12:41333589-41333611 GAGTGAAGGCAGAATGAAGGAGG - Intronic
1095882156 12:47149285-47149307 TAGTTTAAACACAATGAAGCGGG - Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096680631 12:53252942-53252964 CAGTTGAAACCGAAGGAAGGAGG - Exonic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1099070633 12:78042058-78042080 AAGTGAAAACAGAAAGGAGGAGG - Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101475847 12:105047434-105047456 CAGTCTAAACAGGAAGAAGGAGG - Intronic
1101676433 12:106921220-106921242 CACTGGAAAGAGAATGAAGAGGG - Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1102972928 12:117185013-117185035 CAATGTAAACAGAGGGAATGGGG + Intronic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1105237532 13:18572331-18572353 CACTGGTAACAGACTGAAGGGGG - Intergenic
1105687480 13:22799441-22799463 CATTGCAAACAGAATGGAGTAGG + Intergenic
1106886015 13:34184820-34184842 CATTATAAACAGAATGAACAGGG - Intergenic
1108603897 13:52017899-52017921 CAGTGAAAATAGAATAAAGATGG - Intronic
1109477915 13:62908730-62908752 CAGTGTAAATAGAAAGAACTAGG - Intergenic
1110380167 13:74841262-74841284 CAGAGGAATCAGAATGGAGGGGG - Intergenic
1110515732 13:76410541-76410563 CAGTGTAGACAGATAGATGGTGG + Intergenic
1110832850 13:80051577-80051599 CAGTGTGAACATGATGATGGAGG - Intergenic
1110907078 13:80904490-80904512 TATTGTAAACACAATGAGGGAGG - Intergenic
1112225711 13:97537942-97537964 CAGTGTCAACAGCCTGAAGATGG + Intergenic
1112268139 13:97944590-97944612 CAGTGAACACAGCATGAAGTGGG - Intergenic
1112376068 13:98842253-98842275 CTGTGCAAACAGACTGGAGGAGG - Intronic
1112572832 13:100609118-100609140 CAATGCAATCAGAAGGAAGGAGG - Intronic
1115123762 14:29969464-29969486 CAATGTAAACTGAATGTAGCTGG + Intronic
1115808144 14:37075523-37075545 CAGTGTACATAGAGTGACGGGGG + Intronic
1116226411 14:42159135-42159157 CATTGTAAAAAGAATGAAGGGGG + Intergenic
1116911417 14:50469617-50469639 CAGAGGGAACAGAATGAAAGGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117160613 14:52986006-52986028 CAGTCTAAACAGACTAAAGCAGG - Intergenic
1117542289 14:56760002-56760024 CAGTGTCGACAGAGTGAAGGTGG + Intergenic
1117709929 14:58517164-58517186 CAGTGTTAAGAGAATGAAAAAGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1120005260 14:79349357-79349379 CTGTGTAAGCAGAAAGCAGGAGG + Intronic
1120278239 14:82405786-82405808 CATTGTAAACAGAAAGACGCAGG - Intergenic
1120526520 14:85583240-85583262 CACAGTATACAAAATGAAGGTGG - Intronic
1120619067 14:86740412-86740434 CAGTGTAAACCGAAAGTAAGAGG + Intergenic
1120896599 14:89538439-89538461 AAGTGAAGACAGAATGAAGCAGG + Intronic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1120967048 14:90176719-90176741 CAGTTTAAAAATAATGAAAGAGG + Intronic
1123976261 15:25557304-25557326 CAGTATAAACAAAATGCAGCAGG + Intergenic
1124014994 15:25866345-25866367 CAATGTAAATAGAATGTAGAGGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126036502 15:44551061-44551083 CAGGGAAAACAGAATAAAGTGGG - Intronic
1126367599 15:47912020-47912042 CAGAGTAAATAGAATAAAGCAGG - Intergenic
1126481661 15:49129760-49129782 CAATGTCAACAAAATCAAGGAGG - Intronic
1126856766 15:52846699-52846721 CAGTGGAAACAGAGTGACTGGGG + Intergenic
1128099306 15:64985380-64985402 CATTCTAAGGAGAATGAAGGGGG + Intronic
1128161625 15:65426434-65426456 CAATGTAAGCAGAGTGCAGGAGG + Intergenic
1128427685 15:67558807-67558829 TAGTGGAAAGAGACTGAAGGAGG - Intronic
1128542882 15:68549322-68549344 CAGTGTAAACTCCAGGAAGGAGG - Intergenic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1128989670 15:72249204-72249226 CAATGTAAATAGAGTCAAGGTGG + Intronic
1129527742 15:76232306-76232328 CCTGGTAAACAGAATGAAGCAGG - Intronic
1134011023 16:10853216-10853238 CAGAGTGAATAGAATGAAGTAGG + Intergenic
1136370708 16:29834229-29834251 AAGTGGAAACAGCATGAAGCGGG - Intronic
1139521397 16:67484506-67484528 CAGTGGAAAAAAGATGAAGGGGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1145088637 17:19967196-19967218 CAGTGTACAGAGATTGAAGTGGG - Intronic
1145815887 17:27794552-27794574 CAGTTAAAGCAGAATGAAAGAGG + Intronic
1145951091 17:28818061-28818083 CAGTTTAAAAGGCATGAAGGTGG + Intronic
1146542524 17:33709955-33709977 CAATGCAAAAAGAAAGAAGGGGG - Intronic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151566290 17:74900475-74900497 CAGGCTCAAGAGAATGAAGGAGG + Intergenic
1152480754 17:80550749-80550771 CAGTGGAGACAAAATGAAGCAGG - Intronic
1152889542 17:82872752-82872774 CAGTGAAACCAGAATGACGGTGG - Intronic
1152985594 18:317884-317906 CTGTGAAAACAGCATGAATGGGG + Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1154292812 18:13125294-13125316 CTGTGCAAACACAGTGAAGGAGG + Intergenic
1155753885 18:29465242-29465264 CAGTGTACAATGAATGAACGTGG - Intergenic
1157698883 18:49746857-49746879 GAGAGAAAACAGAATGAATGTGG - Intergenic
1157984923 18:52426225-52426247 CAATGAGAACATAATGAAGGTGG + Intronic
1158029078 18:52940474-52940496 CAGCGTAAATAGAATCATGGTGG - Intronic
1158738663 18:60113575-60113597 CAGTGTTCACATAATGTAGGAGG - Intergenic
1158850830 18:61494563-61494585 CTGGGTAAAGAGAATGAAAGTGG - Intronic
1164245916 19:23428801-23428823 CCGTGGAAACAAAATGAAAGTGG + Intergenic
1165454580 19:35903328-35903350 CTGTGGAAAGAGAAAGAAGGTGG - Intronic
1168679024 19:58300378-58300400 CAGTGAAGACTGAAAGAAGGGGG + Exonic
925501085 2:4505632-4505654 CATTTTAAGCAGAAAGAAGGTGG - Intergenic
925852028 2:8091137-8091159 CTGTGTAGCCAGAATGAGGGAGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926718901 2:15943947-15943969 CAGTGTTTTCAGAATGCAGGTGG + Intronic
929489720 2:42385476-42385498 CAGTGTCAGCAAAATGCAGGAGG + Intronic
929570913 2:43022318-43022340 CAGGGCAGTCAGAATGAAGGCGG + Intergenic
930868875 2:56149897-56149919 CAGGAAGAACAGAATGAAGGTGG + Intergenic
931912385 2:66914809-66914831 GAGTGTAAACAGAATGAAATTGG + Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
933591155 2:84233990-84234012 CAGTAAAAACAAAATGAAGTTGG + Intergenic
935379359 2:102435306-102435328 AAGTGGAAACAGAAAGAAGGTGG + Intronic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
939463098 2:142522921-142522943 CTGTGAAAACAGATTCAAGGTGG - Intergenic
939604118 2:144231822-144231844 CACTATACACAGAATGAAAGAGG + Intronic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943256569 2:185601177-185601199 CTGTGGAAAGTGAATGAAGGGGG + Intergenic
943814460 2:192234986-192235008 CAGGTTAAACAGAGTGAATGTGG - Intergenic
944078931 2:195763201-195763223 CAGTGAAAACAGTAGTAAGGTGG + Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
945714631 2:213343005-213343027 TGGTGTACACAGAAGGAAGGAGG + Intronic
949071820 2:242029773-242029795 CAGTACACACAGACTGAAGGAGG + Intergenic
1170330347 20:15202811-15202833 CAGTGTAGACAGAAAGAAAAAGG + Intronic
1170675024 20:18471085-18471107 CAGTATAAACAAATTGTAGGTGG - Intronic
1171154731 20:22861581-22861603 CAATGGAAAGAGAATGCAGGTGG - Intergenic
1172587471 20:36094617-36094639 GAGTGTAAAAGGAAGGAAGGTGG + Intronic
1173384615 20:42575888-42575910 AAGTGAAAGCAGAATGGAGGAGG - Intronic
1176781522 21:13200608-13200630 CATTGGTAACAGACTGAAGGGGG - Intergenic
1178183104 21:30187003-30187025 CATTGTTTGCAGAATGAAGGCGG + Intergenic
1178329641 21:31676648-31676670 AAGAGTAGACAGGATGAAGGAGG - Intronic
1178485694 21:33019002-33019024 CAGTGGAAACAGATTTCAGGGGG + Intergenic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
952052813 3:29406223-29406245 CAGTCTCAACAGAATGAATTTGG - Intronic
952787651 3:37171544-37171566 TTTTGTAAACAGAATAAAGGAGG - Intronic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
955324452 3:57999207-57999229 CTGTGGTAAGAGAATGAAGGCGG - Intergenic
955533951 3:59903680-59903702 AAGTTTAAACAGAATAAAGGAGG + Intronic
956558197 3:70544081-70544103 CAGTGTAAATACAATTAGGGAGG + Intergenic
957393093 3:79604202-79604224 AAGTGTAATCAGAATAAAGGGGG + Intronic
957946706 3:87072501-87072523 CAGTGAAAACAGCATGAACTTGG - Intergenic
960389191 3:117056036-117056058 CATTGTAAACAGAAAGGAGATGG - Intronic
961362414 3:126376194-126376216 CAGAGGAAACAGAGTGGAGGCGG + Intergenic
961972336 3:130982666-130982688 AAGTGTAAAATAAATGAAGGAGG - Intronic
963291057 3:143489716-143489738 CAGTGTAAACAGAGTAAAAAAGG + Intronic
965784530 3:172321934-172321956 CACTGTAAACAGCTAGAAGGTGG - Intronic
967202893 3:187089601-187089623 CTGAGTAAAAAGAATGAAGCTGG - Intergenic
967642501 3:191882645-191882667 CAGCCTTAACAGAATAAAGGGGG - Intergenic
970434852 4:16023471-16023493 CAGTGTGGAGAGAATGAGGGAGG - Intronic
971810974 4:31426691-31426713 TAGTGGAAACAGAATTAAAGAGG - Intergenic
971906320 4:32731316-32731338 TAGTGTTTACAGAATGAATGTGG - Intergenic
972737823 4:41862967-41862989 CAGTGAAAACAAAATCAAGCTGG + Intergenic
973120711 4:46518436-46518458 CCGTCTAATCAGAATGAGGGTGG + Intergenic
974446702 4:61993589-61993611 CAGGGTAGAAACAATGAAGGAGG - Intronic
975395978 4:73873673-73873695 AGGTGTAAACATAATGAAGAGGG - Intergenic
976066864 4:81197774-81197796 TAGTGAAAAAAAAATGAAGGAGG + Intronic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978387343 4:108189275-108189297 ATGTGGAAACACAATGAAGGAGG - Intergenic
978652786 4:111027297-111027319 CAGTGACAACAGGAAGAAGGAGG - Intergenic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
980096712 4:128499149-128499171 CCGAGGAAAAAGAATGAAGGTGG - Intergenic
980140468 4:128909997-128910019 CAGAGAAACCAGAGTGAAGGCGG + Intronic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
984432468 4:179666094-179666116 CAGAGTACACAAAATGTAGGGGG - Intergenic
984924140 4:184791811-184791833 GGGTGTAAGCAGAAAGAAGGAGG + Intronic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
985702714 5:1383262-1383284 CACTGTGGAGAGAATGAAGGAGG - Intergenic
986615238 5:9610151-9610173 CAGAGGTAACAGAATGAAGCTGG + Intergenic
987212538 5:15697604-15697626 GAGTGAGAACAGAATGATGGAGG + Intronic
987527145 5:19067023-19067045 CTGTGTAAAAAGTTTGAAGGAGG - Intergenic
987759088 5:22135917-22135939 CAGTGAAAACAGAGTCAAGAGGG - Intronic
987857717 5:23442888-23442910 CAGTGTATTCAGACTTAAGGTGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989398105 5:40980161-40980183 CAGAGTAAAAATCATGAAGGTGG - Intronic
990204636 5:53415590-53415612 CAGTGTATACATAATGAAATGGG - Intergenic
990886650 5:60602081-60602103 CATTGTTAACAGAATGTAAGTGG + Intronic
991893800 5:71369363-71369385 CAGTGAAAACAGAGTCAAGAGGG - Intergenic
992009450 5:72512203-72512225 CACTGTGCAAAGAATGAAGGAGG + Intergenic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994126777 5:96176453-96176475 GAATGTAGACAGAATGAAGGTGG - Intergenic
994674747 5:102806181-102806203 CTGTCTAAACAGAATTAGGGTGG - Intronic
995443050 5:112212856-112212878 CAGTCTAAAGAGAATGAGGGTGG - Intronic
998744557 5:145243372-145243394 CAGGGTTAACAGAATGAAAAGGG + Intergenic
998965710 5:147538468-147538490 CAGAGAAAACAGAATGAACATGG - Intergenic
1002184791 5:177449268-177449290 CAGTGTACACAGCCTGGAGGCGG - Intronic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1002393636 5:178936466-178936488 GAGTTAAAACAGAAAGAAGGGGG - Intergenic
1002845760 6:942933-942955 CAGTGCAAAAAGAATGCAGCAGG + Intergenic
1003081674 6:3026359-3026381 AAGTGTATACACAAAGAAGGAGG + Intergenic
1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG + Intergenic
1004057711 6:12157690-12157712 CAGTGAAAATAGAATAAATGGGG - Intronic
1005817930 6:29571962-29571984 CAGAGTAAAAAGAATATAGGAGG + Intronic
1007258474 6:40545302-40545324 CCCTGGACACAGAATGAAGGTGG + Intronic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1008748080 6:54697710-54697732 CAATGAAAACAGAATGATGAGGG + Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1009708915 6:67292376-67292398 AAGTGCAAACACAATGAAGATGG + Intergenic
1011058445 6:83233185-83233207 CAGTGAAAAGAGAATGAAAAGGG - Intronic
1013316194 6:108945616-108945638 AAGTCTAAACAGAATGAGAGAGG - Intronic
1015264393 6:131276029-131276051 CAGTGTAAAAATGATGAGGGTGG + Intronic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1017970725 6:159310432-159310454 CAGTGTAGCCAGAATAAAGCAGG + Intergenic
1018697652 6:166402930-166402952 CCCTGTAAACATACTGAAGGTGG - Intergenic
1019224474 6:170498780-170498802 ATGCGTGAACAGAATGAAGGGGG + Intergenic
1020083209 7:5297342-5297364 AAGAGTACACAGAATAAAGGAGG - Intronic
1022628433 7:32062112-32062134 GAGTGGGAACAGAATGAATGGGG - Intronic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1023536033 7:41212085-41212107 CAATGTTGACAAAATGAAGGTGG - Intergenic
1024205213 7:47153340-47153362 CATTGTAAACAGGATGAAATAGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1025714100 7:63938342-63938364 CAGTGAAGACACAATGAAGCAGG - Intergenic
1029372919 7:100160593-100160615 CAGTGGAAACAGGATGGATGAGG + Exonic
1029444963 7:100606652-100606674 AAGGGGAAACAGACTGAAGGGGG + Intronic
1030337991 7:108346166-108346188 CAGTGTCAACACAATTTAGGAGG + Intronic
1030619205 7:111771038-111771060 CTGTGCAAACTGAATGGAGGGGG - Intronic
1030700250 7:112630282-112630304 CAGGATAAAAAGAATGGAGGAGG - Intergenic
1031573434 7:123386673-123386695 CAGAGGAAACAGACTGAAGTAGG - Intergenic
1031602278 7:123724854-123724876 CATTTAAAACAGTATGAAGGGGG - Intronic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1032380619 7:131476026-131476048 CCATGTTAACAGAATGAAGGAGG + Intronic
1032498962 7:132385366-132385388 TACTGTAAACAGAAAGGAGGAGG - Intronic
1034441815 7:151089489-151089511 AAGTCTAAACAGAGTGAGGGAGG - Intronic
1035696827 8:1604110-1604132 CAGTGTCCACAAAATGAAGAAGG - Intronic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1039016005 8:33149505-33149527 AAGTGTAACCAGATTGAAGATGG - Intergenic
1039039622 8:33395095-33395117 CACTGTAAGAAGACTGAAGGTGG + Intronic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039867910 8:41521764-41521786 AATTGTAAAAAGAAGGAAGGAGG + Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1040500802 8:48003350-48003372 CAGGGAAAACATAATGAAAGTGG + Intergenic
1041646210 8:60255161-60255183 CAGTTGAAACAGAATACAGGAGG - Intronic
1042837592 8:73092445-73092467 GAGGGTTGACAGAATGAAGGTGG + Intronic
1043617776 8:82148208-82148230 CAATCTAAACAGATTGAAGGAGG - Intergenic
1044815094 8:96103677-96103699 AAGAGCAAACAGAATGAATGAGG + Intergenic
1045146463 8:99350145-99350167 CTTTTCAAACAGAATGAAGGGGG + Intronic
1045653340 8:104363180-104363202 CATTGGACACAGAAAGAAGGCGG - Intronic
1046701671 8:117407778-117407800 CAGTGTCACCATAATGTAGGAGG + Intergenic
1046829663 8:118730560-118730582 CAGTATAAACACATTGAGGGAGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048608548 8:135996497-135996519 CAAGGTAACCACAATGAAGGAGG + Intergenic
1050317923 9:4422500-4422522 CAGGGGAAACAGAATCCAGGTGG - Intergenic
1050791340 9:9474383-9474405 CTGTGTAAAAAGAATAAAGCTGG - Intronic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1051984829 9:23071289-23071311 CAGTGGAAGCAGAATTATGGAGG - Intergenic
1052022665 9:23542849-23542871 AAATGTAAACAGATTCAAGGAGG + Intergenic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1053469286 9:38334500-38334522 TAGGGGAAACAGAATGAAAGAGG - Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1058222691 9:102322185-102322207 CAGTTTATATAGAATAAAGGAGG + Intergenic
1059181604 9:112219007-112219029 CAGTGTGAACAGAATGGATTAGG - Exonic
1059702736 9:116791513-116791535 CAGTGTAAACAAGATCATGGGGG + Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061212842 9:129203518-129203540 CAGAGGGAACAGCATGAAGGAGG + Intergenic
1061944718 9:133902181-133902203 CAGTGTATAGACAATGAAGTTGG - Intronic
1186739573 X:12503314-12503336 TTGTGTACACAGGATGAAGGTGG - Intronic
1190905422 X:54722404-54722426 CAGTGTAAGCTCTATGAAGGTGG + Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1195001109 X:100644364-100644386 CAGTGTTAACAGAATCCCGGAGG + Exonic
1196187751 X:112762664-112762686 CAGTGTAAAAACAATGAAAACGG + Intergenic
1196591254 X:117487554-117487576 CAGAATAAACAGAATAAAAGAGG + Intergenic
1196927499 X:120647903-120647925 CAGAGTGAATACAATGAAGGAGG - Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197712311 X:129680155-129680177 CAGAGTGAACAGATTGGAGGGGG + Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1200655885 Y:5901711-5901733 CAGAGTGCAAAGAATGAAGGAGG - Intergenic
1201984500 Y:19951053-19951075 CTGAGTAAAAAGAGTGAAGGAGG - Intergenic