ID: 985485873

View in Genome Browser
Species Human (GRCh38)
Location 5:148725-148747
Sequence TGAGATTCCCTATGAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1357
Summary {0: 1, 1: 6, 2: 90, 3: 273, 4: 987}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985485873_985485877 26 Left 985485873 5:148725-148747 CCTGAAATTCATAGGGAATCTCA 0: 1
1: 6
2: 90
3: 273
4: 987
Right 985485877 5:148774-148796 GTAAAAAATAAAAACAAAGCTGG No data
985485873_985485878 29 Left 985485873 5:148725-148747 CCTGAAATTCATAGGGAATCTCA 0: 1
1: 6
2: 90
3: 273
4: 987
Right 985485878 5:148777-148799 AAAAATAAAAACAAAGCTGGAGG 0: 1
1: 40
2: 334
3: 2230
4: 14114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985485873 Original CRISPR TGAGATTCCCTATGAATTTC AGG (reversed) Intronic
900212798 1:1464764-1464786 TGAGATTCCATATGAATTTTAGG + Intronic
900317395 1:2064839-2064861 TGAGATTCCAGATGAATTTTAGG + Intronic
901309114 1:8255312-8255334 TGATATTCTGTATGAATTTTAGG + Intergenic
901418351 1:9132896-9132918 TGCGATTCCCTATCAATTTGAGG + Intergenic
901682809 1:10924787-10924809 TGAAATTCCATATGAATTTAAGG + Intergenic
901951599 1:12753371-12753393 TGAGATTTTATATGAATTTTAGG - Intronic
902811339 1:18889697-18889719 TGAGATTTCATATAAGTTTCAGG - Intronic
902982436 1:20134835-20134857 TGAATTTCCATATGAATTTTGGG + Intergenic
903085525 1:20854318-20854340 TGAGTTTCCCTTTTAATTTAGGG + Intronic
903100658 1:21026054-21026076 TGAGAATACATATGAATATCAGG - Intronic
903195582 1:21685027-21685049 TGTGGTTCCATATGAATTTTAGG + Intronic
903520721 1:23946264-23946286 TGAAATTCCTTATGAATTTTAGG + Intergenic
903599043 1:24520959-24520981 TGAGGTTCTATATGAATTTCAGG - Intronic
904315693 1:29659681-29659703 TAAGATTCCGTATGAATTTTAGG + Intergenic
904367725 1:30026236-30026258 TGAGATTCCACACAAATTTCAGG - Intergenic
905073548 1:35248997-35249019 TGAAATTCCATATGAATTTCAGG + Intergenic
905288087 1:36898702-36898724 TGCAATTCCATATGAATTTTAGG - Intronic
905406613 1:37737096-37737118 TTAGATTCCATATGAATTTTAGG - Intronic
905505099 1:38472438-38472460 TGACATTCCATATGAATTTTAGG - Intergenic
905750905 1:40462977-40462999 TGAGAAACCCTATGAATGTAAGG + Exonic
906029815 1:42709559-42709581 TGTGGTTCCGTATGAATTTTAGG + Intergenic
906977396 1:50590156-50590178 TGAAATTCCATATGAATTTTTGG + Intronic
907057502 1:51384231-51384253 TGAGATTCCATATGAATTTTAGG - Intronic
907178030 1:52543887-52543909 TGAGATTCCATGTGAATTTTAGG - Intronic
907340658 1:53733581-53733603 AAAGATTCCCTAAGAATCTCGGG - Intronic
907452632 1:54556380-54556402 TGTGGTTCCATATGAATTTTAGG + Intronic
907525359 1:55050733-55050755 TGAGATCCCACATGAATTTCAGG - Intronic
907621364 1:55983958-55983980 TGAAATTCCAAATCAATTTCTGG - Intergenic
907963334 1:59304556-59304578 TGTGGTTCCATATGAATTTTAGG + Intronic
908175165 1:61547990-61548012 TGTGATTCCATATAAATTTTAGG + Intergenic
908184593 1:61640597-61640619 TGGGACTGCTTATGAATTTCGGG - Intergenic
908278679 1:62505400-62505422 TAAGATTGGCTATTAATTTCAGG + Intronic
908288315 1:62634413-62634435 TGAATTTCCCTATGAATTCTAGG - Intronic
908372835 1:63500785-63500807 TGTAATTCCATATGAATTTTGGG - Intronic
908462669 1:64360764-64360786 TGAGATGCCATATGAATTTTAGG - Intergenic
908883771 1:68763735-68763757 TTTGGTTCCATATGAATTTCAGG - Intergenic
908889905 1:68834449-68834471 TGAGATTCCATATGAACTTTAGG - Intergenic
909224533 1:73000928-73000950 GGAGATACACTATGAATTTTGGG + Intergenic
909537709 1:76756933-76756955 AGTCATTCCCTCTGAATTTCAGG + Intergenic
909551467 1:76902533-76902555 TGCAATTCCATATGAATTTTGGG - Intronic
909633287 1:77788898-77788920 TGAGATTCCGTATGACATTTAGG + Intronic
909871031 1:80739335-80739357 TGTGATTCCATATAAATTTTAGG - Intergenic
909922193 1:81396020-81396042 TGAGGTTCCATATTAATTTTAGG + Intronic
910705093 1:90120780-90120802 TGTGATTCCATATAAATTTTAGG + Intergenic
910706620 1:90137049-90137071 TGAGATTCCATATGAAATTTGGG + Intergenic
910785059 1:90988537-90988559 TGAGATTCCATATGAATTTAAGG - Intronic
911162523 1:94695628-94695650 TGTGGTTCCATATGAATTTTAGG - Intergenic
911615041 1:100001198-100001220 TGTGGTTCCATATGAATTTTAGG + Intronic
912005081 1:104889140-104889162 TGTGATTCCAAATGAATTTTAGG - Intergenic
912198383 1:107426672-107426694 TGGGGTTCCATATGAACTTCAGG + Intronic
912234752 1:107837538-107837560 TTTGGTTCCATATGAATTTCAGG - Intronic
912342141 1:108927298-108927320 TGAGGTTCTATATGAATTTTAGG - Intronic
912434078 1:109646604-109646626 TGTGGTTCCATATGAATTTTAGG + Intergenic
912921473 1:113871536-113871558 GGAGTTTGCCAATGAATTTCTGG - Exonic
913373515 1:118127174-118127196 TGTGATTCCATATTAATTTTAGG + Intronic
913395719 1:118369648-118369670 TGAATTTCCATATGAATTTTAGG + Intergenic
914234712 1:145798653-145798675 TGAGATTCCAAATTAATTTTGGG + Intronic
914360390 1:146930688-146930710 TGACATTTGGTATGAATTTCTGG + Intergenic
914383995 1:147149813-147149835 TAAGATTCCATATGAATGTAAGG - Intergenic
914493356 1:148169209-148169231 TGACATTTGGTATGAATTTCTGG - Intergenic
915036405 1:152929562-152929584 TGTGATTCCATATAAATTTTAGG + Intergenic
915043431 1:152988668-152988690 TGTGATTCCATGTGAATTTAAGG - Intergenic
915045859 1:153015056-153015078 TGAGATTCCAGATGGATTTTAGG + Intergenic
915057485 1:153148533-153148555 TGAAATACCCTATGTACTTCTGG + Intergenic
915159275 1:153905501-153905523 TGAGATGCCATATGAATTTTAGG - Intronic
915388257 1:155517101-155517123 TGAGATTCCATATGGATTTTAGG - Intronic
915712491 1:157914267-157914289 TGAGATTCCATACAAATTTTAGG - Intergenic
916355662 1:163904093-163904115 TGTGATTCCATATAAATTTTAGG + Intergenic
916453348 1:164943211-164943233 TAAAATTCCATATGAATTTTAGG + Intergenic
916453474 1:164944963-164944985 TGTGGTTCCGTATGAATTTTAGG + Intergenic
917375238 1:174345278-174345300 TGTGATTCCATATAAATTTTAGG + Intronic
917607480 1:176647932-176647954 TGAGGTTCCATATAAATTTCAGG + Intronic
917921248 1:179751955-179751977 TGTGGTTCCATATGAATTTTAGG - Intronic
917946676 1:179980023-179980045 TGTGTTTCCATATGGATTTCAGG + Intronic
918031835 1:180821537-180821559 TGGAATTCCATATGAATTTAAGG + Intronic
918256134 1:182749582-182749604 TGTGATTCCATATGAATTTTAGG + Intergenic
918652735 1:186985810-186985832 TTGGAATCCCAATGAATTTCAGG + Intronic
918783586 1:188733649-188733671 TGAGCTTACCTAGGAAGTTCTGG + Intergenic
918797650 1:188924192-188924214 TGTGGTTCCTTATGAATTTTAGG - Intergenic
918898289 1:190378024-190378046 TGAGATTCCATATTAATTTTAGG - Intronic
919109207 1:193196466-193196488 TGAGATTCCATGTGACTTTTAGG + Intronic
919436480 1:197568500-197568522 TGTGGTTCCATATGAATTTTAGG - Intronic
919444668 1:197688321-197688343 TGTGGTTCCATATGAATTTTAGG - Intronic
919481573 1:198096589-198096611 TCAGATTCCAGATGAATATCAGG + Intergenic
919585893 1:199439608-199439630 TGTGTTTCCATATAAATTTCAGG - Intergenic
920448045 1:206035012-206035034 TTAGATTCCCTAGCATTTTCTGG - Intergenic
920894324 1:210029738-210029760 TGAGATTCCATATGAATTTTAGG + Intronic
920998841 1:211021976-211021998 TGTGATTCCATATAAATTTTAGG - Intronic
921044268 1:211462357-211462379 CGTGATTCCATATGAATTTTAGG - Intergenic
921195995 1:212758781-212758803 TCAAATTCCATATGAATTTTGGG - Intronic
921230091 1:213061191-213061213 TGAAATTCAATATGAATTTTAGG + Intronic
921701850 1:218277729-218277751 TGAAATTCCATATAAATTTTAGG + Intergenic
921753921 1:218830590-218830612 TGTGTTTCCAAATGAATTTCAGG - Intergenic
921798544 1:219375648-219375670 TTAGATTCCACATGAATTTTAGG - Intergenic
921870117 1:220131075-220131097 TGTGTTTCCTTATGAATTTTAGG + Intronic
922278822 1:224103001-224103023 TTTGATTCCATATGAATTTTAGG + Intergenic
922394949 1:225188677-225188699 TGCAATTCCATATGAATTTAAGG + Intronic
922630693 1:227107041-227107063 TGCAATTCCATATGAATTTGAGG + Intronic
922708931 1:227812373-227812395 TGTGGTTCCATATGAATTTAAGG - Intergenic
923138241 1:231137598-231137620 TGAGTTTCCATATTAATTTTAGG + Intergenic
923244326 1:232117485-232117507 TGAAATTCCATATGGATTTGAGG + Intergenic
923289859 1:232534040-232534062 TGAGGTTTCATATGAATTTTAGG - Intronic
923421604 1:233821625-233821647 TGTGATTCAGTATGAATTTTAGG + Intergenic
924488161 1:244507959-244507981 TGTGGTTCCATATGAATTTTAGG + Intronic
924536943 1:244943438-244943460 TGAGATTCCATATGAATTTTAGG - Intergenic
924649364 1:245910444-245910466 TGTTGTTCCATATGAATTTCCGG - Intronic
924894551 1:248321883-248321905 TTTGATTCCATATGAATTTTAGG - Intergenic
1063083917 10:2797026-2797048 TGTGATTCAATATGAATTTGAGG - Intergenic
1063164635 10:3449616-3449638 TGTGATTGCTTATGAATTTTAGG + Intergenic
1064372790 10:14768297-14768319 TGAGATTCTCTATAAATTTTAGG - Intronic
1064497153 10:15923015-15923037 TGAGATTCTATATGAATTTTAGG + Intergenic
1064503132 10:15996482-15996504 TGTGGTTCCATATGAATTTTAGG + Intergenic
1064572450 10:16708570-16708592 TGTGGTTCCATATGAATTTTAGG + Intronic
1064680284 10:17804876-17804898 TGAAATTCCATATGAACTTTAGG + Intergenic
1064696395 10:17970276-17970298 TGTGATTCCATATAAATTTTAGG + Intronic
1064700471 10:18013955-18013977 TGAGATTTCATATGAATTTTAGG + Intronic
1064800155 10:19061432-19061454 TGAGATTCTACATGAATTTCAGG - Intronic
1065074922 10:22067806-22067828 TGAGATTCCATATGAATATTAGG + Intergenic
1065401727 10:25310385-25310407 TGAGATTACATATGAATTTTAGG + Intronic
1065459536 10:25943368-25943390 TGAGATTCCATATGAGTTTTAGG + Intronic
1065591859 10:27270805-27270827 TGACATTCTGTATGAATTTTAGG + Intergenic
1065907315 10:30268604-30268626 TGTGGTTCCATATGAATTTTAGG - Intergenic
1066016492 10:31249906-31249928 TGAGATTCCATATGAATTTTAGG + Intergenic
1066095208 10:32065802-32065824 TGTGGTTCCATATGAATTTCTGG + Intergenic
1066141556 10:32508540-32508562 TGAAATTGCATATGAATTTTAGG - Intronic
1066150906 10:32616151-32616173 TTTGATTCCATATGAATTTTAGG + Intronic
1066711722 10:38243150-38243172 TGTGGTTCCATATGAATTTTAGG - Intergenic
1067023665 10:42824974-42824996 TGTGGTTCCATATGAGTTTCAGG + Intronic
1067353470 10:45499922-45499944 TGTGATTCCATATAAATTACAGG + Intronic
1067401370 10:45977240-45977262 TGAATTTCCATATGAATTTTAGG - Intronic
1067413751 10:46087713-46087735 TGAGATTCCATATAAATTTTAGG + Intergenic
1067516922 10:46956722-46956744 TGAAATTCCATATGAATTTTAGG + Intronic
1067645330 10:48095104-48095126 TGAAATTCCATATGAATTTTAGG - Intergenic
1067869719 10:49946814-49946836 TGAATTTCCATATGAATTTTAGG - Intronic
1068961895 10:62875172-62875194 TGAGATTCCATATGAATTTAAGG + Intronic
1068979664 10:63048868-63048890 TGAATTTCCATATGAATTTTAGG - Intergenic
1069011275 10:63375941-63375963 TGAGATTCTGTATGAATTTCAGG - Intronic
1069088323 10:64168552-64168574 TGAGGTTCCATATGAATTTTAGG + Intergenic
1069271006 10:66527397-66527419 TGAGATTCCATATGAAATTGAGG + Intronic
1070214190 10:74359306-74359328 TGTGGTTCCATATGAATTTTAGG + Intronic
1071833927 10:89400266-89400288 TGACATTTCATATGAATTTTAGG + Intronic
1071956251 10:90763125-90763147 TCTGATTCCATATGAATTTTAGG + Intronic
1072142152 10:92598580-92598602 TGGGATTCCATATGAATTTGAGG + Intronic
1072266802 10:93737818-93737840 TGGGATTCCATATAAATTTTAGG - Intergenic
1072491885 10:95914904-95914926 TTAGGTTCCCTATAAATTTTAGG + Intronic
1072645957 10:97254179-97254201 TGAGATTCCGTATGAATTTTAGG - Intronic
1072775962 10:98193984-98194006 TGAGATTCCATATGAATTTTAGG - Intronic
1072879489 10:99211354-99211376 TGGGCTTCCATATGAATTTTAGG - Intronic
1072953873 10:99872041-99872063 TGCGTTTCCATATGAATTTTAGG + Intergenic
1072976000 10:100058680-100058702 TAAAATTCCATATGAATTTTAGG - Intronic
1073198502 10:101715381-101715403 TGTGGTTCCATATGAATTTCGGG + Intergenic
1073505277 10:103981818-103981840 TGAGATTCCATGTGAATTTTGGG + Intronic
1073581503 10:104670670-104670692 TGAGATTCCATATGAATTTTAGG + Intronic
1074301594 10:112238622-112238644 TGTGGTTCCATATAAATTTCAGG + Intergenic
1074594755 10:114851672-114851694 TGTAATTCCATATGAATTTTAGG + Intronic
1074667619 10:115748016-115748038 TTAGATTTCATATGAATTTGGGG + Intronic
1074957544 10:118407112-118407134 TCAGATTCCCTGTGGATATCAGG + Intergenic
1075026639 10:118989709-118989731 TGAGATTCCATGTGAATTTTAGG - Intergenic
1075938148 10:126361436-126361458 TGTGATTCCATATAAATTTTAGG - Intronic
1076173762 10:128347305-128347327 TGCAATTCCATATGAATTTTAGG + Intergenic
1076434733 10:130432381-130432403 GGAGTTTCCCCATGAGTTTCCGG - Intergenic
1076592428 10:131593646-131593668 TGAGATTCTATATGAATGTTAGG + Intergenic
1076592745 10:131598346-131598368 TGAGATTCTATATGAATGTTAGG + Intergenic
1076812596 10:132896767-132896789 TGCAATTCCATATGAATTTGAGG - Intronic
1077427196 11:2487364-2487386 TGAGATTCCATATGAATTTTAGG + Intronic
1077449331 11:2626912-2626934 TGAGATTCCATGTGAATTTTAGG + Intronic
1077596989 11:3541688-3541710 TGTGGTTCCATATGAATTTCAGG - Intergenic
1077695689 11:4390580-4390602 TGTGATTCCATATAAATTTTAGG - Intronic
1077924656 11:6669081-6669103 TGAATTTCCATATGAATTTAAGG + Intergenic
1077963989 11:7107486-7107508 TTAGGTTCCATATGAATTTTAGG + Intergenic
1078194989 11:9129192-9129214 TGAATTTCCATATGAATTTTAGG + Intronic
1078254843 11:9649741-9649763 TGAGATTCCATATGAATTTTAGG + Intergenic
1078500443 11:11869587-11869609 TGCCTTTCCCTATAAATTTCAGG + Intronic
1078875932 11:15397201-15397223 TTTGATTCCATATGAATTTTAGG + Intergenic
1079166442 11:18048173-18048195 TGTGATTCCATATAAATTTTAGG - Intergenic
1079474200 11:20811432-20811454 TGAGGTTCCATATTAATTTTAGG + Intronic
1079528912 11:21425249-21425271 TGAAATTCTATATGAATTTTAGG - Intronic
1079727962 11:23900016-23900038 TGAAATTCTATATGAATTTGAGG + Intergenic
1080067273 11:28032368-28032390 TGTGATTCCATATAAATTTTAGG - Intronic
1080570820 11:33555311-33555333 TGAGATTCCATGGGAATTTTAGG - Intronic
1080944998 11:36961921-36961943 TGTGGTTCCATATGAATTTTAGG - Intergenic
1081411963 11:42770014-42770036 TGAGATTCCATATGAATTTTAGG + Intergenic
1081415849 11:42814717-42814739 TGTGGTTCCATATAAATTTCAGG - Intergenic
1081985427 11:47299159-47299181 TGTGGTTCCATATGAATTTTAGG + Intronic
1082280200 11:50263388-50263410 TGAGATTTTGTGTGAATTTCAGG + Intergenic
1082687851 11:56261132-56261154 TTAGGTTCCATATGAATTTTGGG - Intergenic
1082999002 11:59274770-59274792 TGAGAATCCCTCTGGCTTTCTGG + Intergenic
1083005378 11:59340012-59340034 TTTGATTCCTTATGAATTTTAGG + Intergenic
1083030421 11:59586557-59586579 TGAGATTCCATATGAATTTTAGG - Intronic
1084252912 11:67915638-67915660 TGTGGTTCCATATGAATTTCAGG - Intergenic
1084434085 11:69127921-69127943 TGTGGTTCCATATGACTTTCAGG - Intergenic
1084819954 11:71680354-71680376 TGTGGTTCCATATGAATTTCAGG + Intergenic
1084896933 11:72278954-72278976 TGAAGTTCCATATGAATTTTAGG + Intergenic
1084994489 11:72962662-72962684 TGTGATTTCCTATCAAATTCTGG + Intronic
1085144993 11:74187232-74187254 TGAATTTCCATATGAATTTTAGG + Intronic
1085589338 11:77743227-77743249 TGTGGTTCCATATGAATTTTAGG + Intronic
1085980869 11:81723370-81723392 TGTGATTCCTTATGAATTTTAGG - Intergenic
1086382963 11:86277110-86277132 TGAGGTTTTCTATGGATTTCTGG + Exonic
1086446619 11:86877815-86877837 TGCAATTCCATATGAATTTTAGG + Intronic
1086539697 11:87893904-87893926 TGAGATTCCATATGAATCTTAGG + Intergenic
1086611742 11:88765345-88765367 TGAAATTCCATATTAATTTTAGG - Intronic
1087401988 11:97679057-97679079 TGTGATTCCATATAAATTTTAGG + Intergenic
1087490052 11:98814009-98814031 TGAGATTCCATATGAATTTTAGG - Intergenic
1087690158 11:101311569-101311591 TTTGATTCCATATGAATTTTAGG + Intergenic
1087837030 11:102885680-102885702 TGGGCTTCCCTCTGACTTTCAGG - Intergenic
1088007288 11:104957781-104957803 TGTGATTCCATATAAATTTTAGG - Intronic
1088243591 11:107795192-107795214 TGTGGTTCCATATGAATTTTAGG - Intronic
1088502937 11:110501409-110501431 TGAGGTTCCCTATAAATTTTAGG + Intergenic
1088531455 11:110814857-110814879 TGAGATTCCATATAGATTTTAGG + Intergenic
1088642922 11:111890706-111890728 TGAGATTCCATATGAATTTTAGG + Intergenic
1089799278 11:121011484-121011506 TGAGATTCCATATTAATTTTAGG - Intergenic
1089877278 11:121736572-121736594 TGAGATTCCACATGAATTTTAGG + Intergenic
1090164496 11:124533274-124533296 TTTGGTTCCATATGAATTTCAGG - Intergenic
1090722225 11:129486291-129486313 TGTCATTCCATATGAATTTTAGG + Intergenic
1090866778 11:130707912-130707934 TGAGATTCCTTATGAATTTTAGG - Intronic
1091106926 11:132930814-132930836 TGAGATTTCATATAAATTTTAGG - Intronic
1091191966 11:133703424-133703446 TGAGATCCCATATGAATTTTAGG + Intergenic
1091211683 11:133865821-133865843 TGAGATTCCATATACATTTCAGG + Intergenic
1091326041 11:134688733-134688755 GGAGTTTCCATATGAATTTTTGG + Intergenic
1091341316 11:134816429-134816451 TGAGATTGCCTAGATATTTCAGG + Intergenic
1091480153 12:820052-820074 TGAAATTCCATGTGAATTTGAGG + Intronic
1091700527 12:2656581-2656603 TGTGGTTCCATATGAATTTTAGG - Intronic
1091707648 12:2709508-2709530 TGAGATTCCATATAAATTTTAGG - Intergenic
1091910030 12:4222719-4222741 TGAGATTCCATGTGAATGTTAGG + Intergenic
1092423158 12:8350465-8350487 TGTGGTTCCATATGAATTTCAGG - Intergenic
1092438085 12:8469436-8469458 TTTGATTCCATATGAATTTTAGG - Intronic
1092493905 12:8972801-8972823 TGTGATTCCATATAAATTTAAGG + Intronic
1092508803 12:9131270-9131292 CGAGATTCCGTATGAATTTGGGG + Intergenic
1092628224 12:10351114-10351136 TGTGATTCCATATGAATTTCAGG + Intergenic
1092827205 12:12412110-12412132 TGAGATTCCATATGAATTTTTGG + Intronic
1092959768 12:13585153-13585175 CAAGATTCCCAATGAATTTAGGG + Intronic
1093046339 12:14449682-14449704 TGAGATTCCATATGAATTTTAGG + Intronic
1093173712 12:15887024-15887046 TGTGATTACCTATAAATTCCTGG - Intronic
1093202140 12:16201244-16201266 TGTGGTTCCATATGAATTTTAGG - Intronic
1093206124 12:16252802-16252824 TAATATTCCATATGAATTTCAGG - Intronic
1093677494 12:21961000-21961022 TGTAATTACCTATGAATTTTAGG - Intergenic
1093690998 12:22108666-22108688 TTTGATTCCATATGAATTTTAGG - Intronic
1093761006 12:22910723-22910745 TGTGATTCCATATGCATTTAAGG - Intergenic
1093944723 12:25094556-25094578 TTAGATTCCATATGAATTTTGGG + Intronic
1094052227 12:26233207-26233229 TGAAATACCCTGTGAATTACTGG - Intronic
1094258952 12:28469587-28469609 TGTGATTCCATATAAATTACAGG - Intronic
1094388578 12:29922446-29922468 TGGGATTCCATATGAATCTTAGG - Intergenic
1094758653 12:33501837-33501859 TGAGATTCCACATAAATTTTGGG + Intergenic
1094761800 12:33542005-33542027 TGAGATTTTATATGAATTTTAGG - Intergenic
1095432736 12:42151623-42151645 TGTGATTCCATATAAATTTTAGG - Intergenic
1095781082 12:46060506-46060528 TGCGATTCCATATGAATTTTAGG - Intergenic
1095883366 12:47162920-47162942 TAAGATTGCCTATGAATTTTAGG + Intronic
1096294068 12:50368670-50368692 TGAGATTCCATGTAAATTTTAGG - Intronic
1096345950 12:50846962-50846984 TAATATTCCATATGAATTTTAGG + Intronic
1096484023 12:51964947-51964969 TGCAATTCCATATGAATTTTGGG + Intronic
1096554772 12:52396537-52396559 TGAGAGTCACCTTGAATTTCAGG + Intronic
1097073285 12:56372715-56372737 TGAGATTTTATATGAATTTTAGG - Intergenic
1097298735 12:57995898-57995920 TGAGATTCTATATGAATTTTAGG + Intergenic
1097317949 12:58192717-58192739 TGTGGTTCCATATGAATTTGAGG + Intergenic
1097536696 12:60880820-60880842 TGTGATTCCATATAAATTTTAGG - Intergenic
1097831347 12:64227214-64227236 TGTGGTTCCATATGAATTTTGGG + Intergenic
1098546218 12:71714449-71714471 TGAGATTCCATATGAATTTTAGG - Intergenic
1098559873 12:71860244-71860266 TGTGGTTCCATATGAATTTTAGG + Intronic
1098962974 12:76758403-76758425 TGTGGTCCCATATGAATTTCAGG - Intergenic
1099042333 12:77671414-77671436 TTAGGTTCCATATGAATTTTAGG - Intergenic
1099043339 12:77683511-77683533 TGTGATTCCGTATGAATTTTAGG + Intergenic
1100066643 12:90654478-90654500 TGTGGTTCCATATGAATTTTAGG - Intergenic
1100413733 12:94350144-94350166 TGAGATTCCATACGAATTTTAGG - Intronic
1100424205 12:94467914-94467936 TGAGATTCCATATGAATTTTAGG - Intergenic
1100483940 12:95006547-95006569 TGAGATTCCGTATGAATTTTAGG + Intergenic
1100683969 12:96965255-96965277 TGAGATTCCATATGAATTTTAGG - Intergenic
1101171750 12:102104929-102104951 TGAGGTTCCATCTGAATTTTAGG + Intronic
1101498856 12:105282517-105282539 TGACATTCCATATGAATTTTAGG - Intronic
1101608017 12:106264411-106264433 TGTGGTTCCATATAAATTTCAGG - Intronic
1102711430 12:114931345-114931367 TGTGGTTCCATATGAATTTTAGG + Intergenic
1103729219 12:123015186-123015208 TGTAATTCCATATGAATTTTAGG - Intronic
1103813317 12:123633435-123633457 AGAGATTTCTTTTGAATTTCAGG - Intronic
1104819934 12:131671031-131671053 CAAGATTCCATATGAATTTTAGG - Intergenic
1105460771 13:20584116-20584138 TGATATTCCATATGAATTTTAGG + Intronic
1105464291 13:20623302-20623324 TGAAATTGCGTATGAATTTCAGG + Intronic
1105466810 13:20651160-20651182 TGAGATTCCACATGAATATTAGG + Intronic
1105494028 13:20914641-20914663 TGAGATTCCATATGAATGACAGG - Intergenic
1105684098 13:22760573-22760595 TGAGATTTCATATCAATTTTAGG - Intergenic
1105774815 13:23648078-23648100 TGAAATTCCATATGAATTTTAGG + Intronic
1106200401 13:27531836-27531858 TTAAATTCCATATGAATTTTAGG + Intergenic
1106238880 13:27891485-27891507 TGATATTCCATATGAATGTTAGG + Intergenic
1106333169 13:28758466-28758488 TGATATTTCATATGAATTTGAGG + Intergenic
1106566652 13:30890734-30890756 TGAGATCCCCTATGGCTTCCAGG - Intergenic
1107201740 13:37728682-37728704 TGAGATTCCATATGGATTTTAGG - Intronic
1107287375 13:38809820-38809842 TGTGATTCCATATAAATTTTAGG + Intronic
1107361976 13:39628272-39628294 TGAGATTTCATATGAATTTTAGG + Intergenic
1107437877 13:40396869-40396891 TGAAATTCCATATGAATTTTAGG - Intergenic
1108480261 13:50862620-50862642 TGAGATTCCATATGGATTTTAGG - Intergenic
1108787672 13:53925401-53925423 TTTGATTCCCTATGAATTTCAGG - Intergenic
1109046157 13:57413704-57413726 TGTGGTTCCATATGAATTTTAGG - Intergenic
1109176022 13:59156689-59156711 TGTGGTTCCATATGAATTTTAGG - Intergenic
1109196922 13:59388115-59388137 TTTGATTCCATATGAATTTTAGG + Intergenic
1109290693 13:60471499-60471521 TGAGATTCCTTATGAATTATAGG + Intronic
1109323738 13:60841456-60841478 TGTGGTTCCGTATGAATTTTAGG + Intergenic
1109411599 13:61977144-61977166 TGACATTCCATATAAATTTATGG + Intergenic
1109426419 13:62169897-62169919 TGTGGTTCCATATAAATTTCAGG - Intergenic
1109433147 13:62262999-62263021 TGTGATTCCATGTGAATTTTAGG - Intergenic
1109618812 13:64873045-64873067 TGCAATTCCCTATGACTTTTAGG - Intergenic
1109914265 13:68960061-68960083 TGAGATTCCTTGGGGATTTCTGG + Intergenic
1109934051 13:69258041-69258063 TGTGGTTCCATATGAATTTTAGG - Intergenic
1110062367 13:71058130-71058152 TGAGAGTCCATATGAATTTTAGG + Intergenic
1110210184 13:72962782-72962804 TGAAATTCCATATGAATTTTAGG - Intronic
1110227093 13:73131158-73131180 TGAGATTCCCCATGAACTTGAGG + Intergenic
1110259454 13:73468946-73468968 TTTGATTCCATATGAATTTTAGG - Intergenic
1110590179 13:77247575-77247597 AGAGATTTTCTATGAATTTTAGG - Intronic
1110762523 13:79246006-79246028 TGAGAATACCTGTGAATATCTGG - Intergenic
1111472281 13:88698469-88698491 TGTGGTTCCATATGAATTTTAGG + Intergenic
1111769759 13:92582489-92582511 TGAGATTCCATATAAATTTTAGG + Intronic
1111823200 13:93238055-93238077 TGTGGTTCCATATGAATTTTGGG + Intronic
1113006749 13:105713389-105713411 TGACATTCCATATGAATTTCTGG + Intergenic
1113100908 13:106716764-106716786 TGCATTTCCATATGAATTTCAGG + Intergenic
1113364002 13:109659382-109659404 TGTGGTTCCATATGAATTTTAGG - Intergenic
1113511805 13:110862344-110862366 TGAGATTTCATATGAATTTTAGG + Intergenic
1113546959 13:111160346-111160368 TGTGATTCCATGTGAATTTCAGG + Intronic
1113637773 13:111932314-111932336 TTCGATTCCATATGAATTTTAGG + Intergenic
1113883603 13:113645018-113645040 TGAGATTCTGTATGAATTTTAGG - Intergenic
1114165548 14:20214926-20214948 TGTGATTCCATATGGATTTTAGG + Intergenic
1114223024 14:20713983-20714005 TGAGAACCCCTGTGAATTTCTGG - Intergenic
1114285104 14:21234124-21234146 TGAGATTCCCAATGAATACACGG + Exonic
1114400798 14:22408553-22408575 TGAGATCTCCTAACAATTTCAGG + Intergenic
1115482779 14:33878316-33878338 TGAGATTTCCTATGGCTTTTAGG - Intergenic
1115898211 14:38114959-38114981 TGAGATTCCATATGAATTTTAGG - Intergenic
1116489599 14:45490421-45490443 TGTGATTCCATATAAATTTTAGG + Intergenic
1116495256 14:45552610-45552632 CAAAATTCCCTTTGAATTTCTGG - Intergenic
1116548585 14:46204838-46204860 TGTGGTTACATATGAATTTCAGG - Intergenic
1116808164 14:49513526-49513548 TGGGATTGCTTCTGAATTTCTGG - Intergenic
1116906322 14:50407051-50407073 TGAGACTCCCTGGGAATTTTAGG + Intronic
1117114770 14:52498822-52498844 TGAGATTCCATATGAATTTTAGG - Intronic
1117520215 14:56544055-56544077 TTAGATTCACTGTGAAATTCAGG - Intronic
1117633569 14:57719311-57719333 TGTGATTCCATATGAATTTTAGG + Intronic
1117678004 14:58174358-58174380 TGCAATTCCATATGAATTTGAGG + Intronic
1117782410 14:59247376-59247398 TGAGATTCCATATGCCTTCCTGG + Intronic
1117934225 14:60883571-60883593 TGTGATTCCATATAAATTTTAGG + Intronic
1118033782 14:61843894-61843916 TGAGGTTCCATATAAATTTTAGG + Intergenic
1118114178 14:62756450-62756472 TGTGGTTCCATATGAATTTTAGG - Intronic
1118140543 14:63075877-63075899 TGAGATTCCATATGAATTTTAGG - Intronic
1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG + Intronic
1118413690 14:65509410-65509432 TGTGGTTCCCTATAAATTTTAGG + Intronic
1118546959 14:66901867-66901889 TGTGGTTCCATATGAATTTTAGG + Intronic
1118551350 14:66954126-66954148 TGAGATTCCATATGAATTTCAGG + Intronic
1118557113 14:67036934-67036956 TGAAATTCTATATGAATTTTAGG - Intronic
1118561010 14:67082618-67082640 TGAGATTCCATATAAATTTTAGG + Intronic
1118570821 14:67194058-67194080 TTAGGTTCACTATGAATATCTGG - Intronic
1118969951 14:70627262-70627284 TGAAATTCCATATGAATTTTAGG - Intergenic
1119121330 14:72081007-72081029 TGTGGTTCCATATGAATTTTAGG + Intronic
1119121387 14:72082140-72082162 TGTGGTTCCATATGAATTTTAGG + Intronic
1119455119 14:74748482-74748504 TGAGATTTTGTATGAATTTTAGG - Intergenic
1119562203 14:75599607-75599629 TGAAATCCCATATGAATTTTAGG - Intronic
1119582309 14:75796916-75796938 TTTGGTTCCATATGAATTTCAGG + Intronic
1120660695 14:87247111-87247133 TGAGATTCTATATGAATTTTAGG + Intergenic
1121367550 14:93328265-93328287 TGAGATGCCATATGAATTTTAGG - Intronic
1121488013 14:94334238-94334260 TGTGGTTCCATATGAATTTTAGG + Intergenic
1121634134 14:95442369-95442391 GTATATTCCCTATGAATTTCAGG + Intronic
1121672118 14:95718483-95718505 TGTGGTTCCATATGAATTTTAGG + Intergenic
1122170252 14:99867317-99867339 TGATATTCCATATGAATTTTAGG + Intronic
1122432387 14:101662378-101662400 TGAGATTCCATACAAATTTTAGG + Intergenic
1122450430 14:101801841-101801863 TGATATTCCCTATGAATCTTAGG - Intronic
1122453006 14:101826664-101826686 TGTGTTTCCATATGAATTTTAGG + Intronic
1122618779 14:103040926-103040948 TGAGTTTCCATATGCATTTTAGG - Intronic
1122648580 14:103211494-103211516 TGAGAGTCCATATGAATTCTAGG + Intergenic
1122752342 14:103947038-103947060 TGACATTCCATATGAATTTCAGG - Intronic
1122908353 14:104813617-104813639 TAAGATTTCCTGTGAATTTTGGG + Intergenic
1202839230 14_GL000009v2_random:105653-105675 GGAGATTCCATATGAATTTTAGG - Intergenic
1202908608 14_GL000194v1_random:95806-95828 GGAGATTCCATATGAATTTTAGG - Intergenic
1202884648 14_KI270722v1_random:93511-93533 GGAGATTCCATATGAATTTTAGG + Intergenic
1123424807 15:20162002-20162024 TGTGGTTCCATATGAGTTTCAGG + Intergenic
1123462637 15:20487516-20487538 TGTGATTCCATACAAATTTCAGG + Intergenic
1123534031 15:21168533-21168555 TGTGGTTCCATATGAGTTTCAGG + Intergenic
1123655424 15:22512886-22512908 TGTGATTCCATACAAATTTCAGG - Intergenic
1123791257 15:23722906-23722928 TGTGGTTCCCTATGAATTTGGGG + Intergenic
1123889795 15:24765132-24765154 TGAGATTCTGTATGAATTTTGGG - Intergenic
1124191701 15:27583816-27583838 TGAGATTCCATATGAATTTTAGG - Intergenic
1124273323 15:28303538-28303560 TGTGATTCCATACAAATTTCAGG + Intronic
1124309332 15:28608081-28608103 TGTGATTCCATACAAATTTCAGG - Intergenic
1124365064 15:29065259-29065281 TGACATTCCCTAGGAAGTGCAGG + Intronic
1124418625 15:29495899-29495921 TGTGGTTCCCTATGAATTTTAGG + Intronic
1124554762 15:30714442-30714464 TGTGGTTTCATATGAATTTCAGG + Intronic
1124676484 15:31691238-31691260 TGTGGTTTCATATGAATTTCAGG - Intronic
1124683807 15:31760708-31760730 TGAATTTCCATATGAATTTTAGG - Intronic
1125059775 15:35405198-35405220 TGGGATTCCATATAAATTTTAGG + Intronic
1125061023 15:35424051-35424073 TGTGGTTCCATATGAATTTTGGG + Intronic
1125214638 15:37257073-37257095 AGTGATTCCATATAAATTTCAGG - Intergenic
1126213183 15:46123342-46123364 TGAGGTTCCCCATGAATTTTAGG + Intergenic
1126279557 15:46928707-46928729 TTTGGTTCCATATGAATTTCAGG + Intergenic
1127040260 15:54967486-54967508 TCTGGTTCCCTATGAATTTTAGG - Intergenic
1127625787 15:60778898-60778920 TGAGGTTTCCTTTGAGTTTCAGG + Intronic
1127730202 15:61793779-61793801 TGTGGTTCCATATGAATTTCAGG + Intergenic
1127740891 15:61903652-61903674 TCAGGTTCCATATGAATTTTAGG - Intronic
1127771809 15:62238092-62238114 TGCAATTCCATATGAATTTTGGG - Intergenic
1127929720 15:63585217-63585239 TGAGAGTCCATGTGAGTTTCAGG + Intronic
1128008297 15:64266522-64266544 TGTGGTTCCATATGAATTTTAGG - Intronic
1128503492 15:68247676-68247698 TGTGGTTCCATATGAATTTTAGG - Intronic
1128627125 15:69221233-69221255 TGAGATTCCATGTGGATTTTTGG + Intronic
1128663323 15:69519295-69519317 TGAGATTTCATATGAATTTTAGG - Intergenic
1128825046 15:70706942-70706964 TGAGATTCCATGTGAATGTTAGG - Intronic
1128871459 15:71159305-71159327 TGTGGTTCCATATGAATTTTAGG + Intronic
1128996081 15:72295900-72295922 TGAGATTCCATATGAATTTTAGG - Intronic
1129492337 15:75940491-75940513 TCAGATTCCACATGAAATTCAGG - Exonic
1129576357 15:76751378-76751400 TGAGATTCCATATGAATTTTAGG - Intronic
1130173134 15:81537911-81537933 TGTGATTCCATATAAATTTTAGG - Intergenic
1130409945 15:83638523-83638545 TGTGGTTCCATATGAATTTTAGG + Intergenic
1130792941 15:87175467-87175489 TGTGGTTCCATATGAATTTTAGG - Intergenic
1130816289 15:87438228-87438250 TGAGTTTCTATATGAATTTGGGG - Intergenic
1130943568 15:88532462-88532484 TGAGATACCATATGAATTTTAGG - Intronic
1131351989 15:91709401-91709423 TCAAATTCCATATGAATTTGGGG - Intergenic
1131568994 15:93513806-93513828 TGAATTGCCATATGAATTTCAGG - Intergenic
1131630496 15:94171667-94171689 TGAGATTCCCTATCAATTTCAGG - Intergenic
1132730621 16:1359695-1359717 TGAGACTCCCTATGAACTTTAGG + Intronic
1132791813 16:1694489-1694511 TGAAATTCCATATGAATTATAGG - Intronic
1132991177 16:2795462-2795484 TGACATTCCATATAAATTTTAGG + Intergenic
1133375087 16:5279078-5279100 TGTGGTTCCATGTGAATTTCAGG + Intergenic
1134264695 16:12683178-12683200 TGAGATTCCGTTTGAATAACTGG + Intronic
1134411746 16:14008669-14008691 TGAATTTCCATATGAATTTTAGG + Intergenic
1134781318 16:16898651-16898673 TGTGGTTCCATATGAATTTTAGG + Intergenic
1135029689 16:19028480-19028502 TGCGATTCCATATGAATTTTAGG + Intronic
1135223313 16:20633681-20633703 TGAGATTCTATATGCATTTTAGG - Intronic
1135902976 16:26483315-26483337 TGAGATTCCATATACATTTTAGG - Intergenic
1136017577 16:27412478-27412500 TGAAGTTCCATATGAATTTTAGG + Intronic
1136185162 16:28583872-28583894 TGAATTTCCATATGAATTTTAGG + Intronic
1136389497 16:29953556-29953578 TGAGATTCTGTATGAATTTTAGG + Intronic
1136423996 16:30156634-30156656 TGAGTTTCCATATGAATTTTAGG - Intergenic
1136860053 16:33693742-33693764 TGTGGTTCCATATGAGTTTCAGG - Intergenic
1137011473 16:35325601-35325623 TGATATTCCATATGAGTTTTAGG - Intergenic
1137024844 16:35462866-35462888 TGAGATCCCATATGCATTTTAGG + Intergenic
1137024850 16:35462945-35462967 TGAGATTCCATATAAATTTTAGG + Intergenic
1137030122 16:35515680-35515702 TGATATTCCGTAAGAATTTTAGG - Intergenic
1137259688 16:46814878-46814900 TGGGATTCCATGTGAATTTTAGG - Intronic
1137981141 16:53070984-53071006 TGGGATTGCTTATGAATTTTAGG + Intronic
1138048178 16:53748153-53748175 TGTGGTTCCATATGAATTTTAGG + Intronic
1138118395 16:54378713-54378735 TGTGATTTCCTTTGAATCTCTGG + Intergenic
1138158378 16:54728053-54728075 TTTGATTCCTTATGAATTTTAGG + Intergenic
1138192481 16:55026440-55026462 TGTGATTCCATATGAATTTTAGG - Intergenic
1138256201 16:55564346-55564368 TGAAATTCCCTATGAATTTTAGG - Intronic
1138326862 16:56180006-56180028 TGAGATTCCATATGAATTTTAGG + Intergenic
1138995265 16:62444105-62444127 TGAGATTCCATATAAATTTTAGG - Intergenic
1140177576 16:72678755-72678777 TGAAATTCCATATTAATTTCAGG - Intergenic
1140543653 16:75784840-75784862 TGTGGTTCCGTATGAATTTTAGG + Intergenic
1141043920 16:80698046-80698068 TGTGCTTCCATATGAATTTTAGG - Intronic
1141221792 16:82077167-82077189 TGTGGTTCCATATAAATTTCAGG - Intronic
1141264467 16:82483733-82483755 TGAGATTTTCTTTTAATTTCAGG - Intergenic
1141908174 16:87041327-87041349 TGAGATTCTTCATGACTTTCTGG + Intergenic
1203121556 16_KI270728v1_random:1541900-1541922 TGTGGTTCCATATGAGTTTCAGG - Intergenic
1142948548 17:3457482-3457504 TGTGGTTCCATATGAATTTTAGG - Intronic
1143058669 17:4181708-4181730 TGAGATTACCTGTTAATTGCAGG - Intronic
1143210295 17:5181546-5181568 TGAGAAACCCTATGAATGTAAGG - Exonic
1143210347 17:5182123-5182145 TGAGAAACCCTATGAATGTAAGG - Exonic
1143210410 17:5182699-5182721 TGAGAAACCCTATGAATGTAAGG - Exonic
1144600114 17:16605184-16605206 TGTAGTTCCATATGAATTTCAGG + Intergenic
1144612207 17:16730477-16730499 TTTGATTCCCTGTGAATTTTAGG + Intronic
1144799722 17:17917391-17917413 TGAGATTTCATGTGAATTTTAGG + Intronic
1144900523 17:18584816-18584838 TTTGATTCCCTGTGAATTTTAGG - Intergenic
1145027648 17:19480826-19480848 TGTGGTTCCATATGAATTTTAGG + Intergenic
1145048336 17:19637701-19637723 TGAGATTCCATATGTGTTTTAGG - Intergenic
1145131923 17:20360865-20360887 TTTGATTCCCTGTGAATTTTAGG + Intergenic
1146041001 17:29454399-29454421 TGAAATTTCATATGAATTTGAGG + Intronic
1146238942 17:31197017-31197039 TGAGATTCCATATGAATTTTAGG + Intronic
1148993988 17:51691989-51692011 TGTGATTCCATATGAATTTTAGG + Intronic
1149041872 17:52199626-52199648 TGTGATACCATATGAATTTTAGG - Intergenic
1149072855 17:52563726-52563748 TTAGATTCCCAATGGATCTCTGG + Intergenic
1149090093 17:52767753-52767775 TTTGGTTCCCTATGAATTTTAGG - Intergenic
1149167766 17:53774115-53774137 TGAGATTCCATATGAATTTTAGG + Intergenic
1150021449 17:61618319-61618341 TGAGATTCATTTTGAAATTCTGG + Intergenic
1150037901 17:61824315-61824337 TGAGAATCCATGTGAATTTTAGG - Intronic
1150187854 17:63204656-63204678 TAAGATTCCATATGACTTTTAGG - Intronic
1150513806 17:65785912-65785934 TGAATTTCCATATAAATTTCAGG + Intronic
1150817557 17:68405180-68405202 TGAGATTCCATGTGAATTTTAGG + Intronic
1151281389 17:73077247-73077269 TGACATTCCCTATGCATCTGGGG + Intronic
1152582863 17:81175436-81175458 TGAGATTCTATATGAATTTTAGG - Intergenic
1153065832 18:1044017-1044039 TGGGGTTCCATATGAATTTTAGG - Intergenic
1153080084 18:1212520-1212542 TGCAGTTCCATATGAATTTCAGG + Intergenic
1153088781 18:1319747-1319769 TGTGGTTCCATATAAATTTCAGG - Intergenic
1153399155 18:4663930-4663952 TGTGATTCCATATAAATTTGTGG - Intergenic
1153831384 18:8926530-8926552 TGAGATTCCATATGAATTTGGGG - Intergenic
1154229058 18:12538001-12538023 TGCAATTCCATATGAATTTTAGG - Intronic
1154938217 18:21083329-21083351 TGAGATTACATTTGAATTTTAGG - Intronic
1155013720 18:21810391-21810413 TGAGATTCCTTATGAATTTCTGG - Intronic
1155291115 18:24343475-24343497 TGAAATTCCATGTGAATTTTAGG - Intronic
1155672252 18:28386224-28386246 TGAAATTCCATATGAATTTTAGG - Intergenic
1155745529 18:29352417-29352439 TAAGATTCACTTTGTATTTCTGG + Intergenic
1155880966 18:31148049-31148071 TAATATTCTCTATGGATTTCTGG + Intronic
1156262078 18:35454033-35454055 TAAGATTCCATTTGAATTTTCGG - Intronic
1156327073 18:36084453-36084475 TTTGGTTCCCTATGAATTTTAGG - Intergenic
1156441682 18:37195792-37195814 TGTGGTTCCATATGAATTTTGGG + Intronic
1158039733 18:53078120-53078142 TGTGATTCCTTATATATTTCTGG - Intronic
1158270556 18:55709845-55709867 TGAAATTCCGTATGAATTTTAGG + Intergenic
1159075108 18:63672236-63672258 TGAAATTCCATATTAATTTTAGG - Intronic
1159504581 18:69318510-69318532 TGTGATTCCATATAAATTTTAGG + Intergenic
1160292539 18:77607581-77607603 TGAAATTCAAAATGAATTTCAGG + Intergenic
1160571705 18:79821915-79821937 TAAGACTCCATATGAATTTTAGG + Intergenic
1161018534 19:1996292-1996314 TGGGATTCCATATGAATTCTAGG + Intronic
1161774932 19:6255729-6255751 TGTGATTCCATATGAACTTGAGG - Intronic
1162243165 19:9374374-9374396 TGTGTTTCCATATGAATTTTAGG + Intronic
1162270492 19:9610976-9610998 TGAGAAACTCTGTGAATTTCAGG - Exonic
1162598967 19:11652541-11652563 AGAGAAGCCCTATGAATGTCAGG + Intergenic
1162614768 19:11789639-11789661 TGTGGTTCCATATAAATTTCAGG - Intergenic
1162628475 19:11905717-11905739 AGAGAAGCCCTATGAATGTCAGG + Intronic
1162663184 19:12187038-12187060 AGAGAAACCCTATGAATGTCAGG + Exonic
1162665893 19:12211381-12211403 TGAGATTCCCTGTGAATTTTAGG + Intergenic
1162701820 19:12521553-12521575 TGTGGTTCCATATGAATTTTAGG - Intronic
1162702401 19:12526835-12526857 AGAGAAACCCTATGAATGTCAGG - Exonic
1162702463 19:12527423-12527445 AGAGAAACCCTATGAATGTCAGG - Exonic
1162702482 19:12527591-12527613 TGAGAAACCCTATGCATGTCCGG - Exonic
1163056477 19:14723415-14723437 TGAGATTTCATATGAGTTTTAGG + Intronic
1163384920 19:16993711-16993733 TGCGATGCCCTGTGAATTTCAGG - Intronic
1163684928 19:18706651-18706673 TGAGATTCTGTATGGATTTTAGG + Intronic
1163684997 19:18707588-18707610 TGAGATCCCATATGGATTTTAGG + Intronic
1164150845 19:22549453-22549475 TGTGGTTCCATATGAATTTTAGG - Intergenic
1164387776 19:27791180-27791202 TGAGATTCCATATGAAATTTAGG - Intergenic
1164962756 19:32449423-32449445 TGAGTTTCCATATGAATTTCAGG - Intronic
1165524319 19:36340628-36340650 TGAGAAACCCTATGAATGTATGG - Exonic
1165524332 19:36340796-36340818 TGAGAAACCCTATGAATGTAAGG - Exonic
1165524347 19:36340964-36340986 TGAGAAACCCTATGAATGTAAGG - Exonic
1165524365 19:36341132-36341154 TGAGAAACCCTATGAATGTAAGG - Exonic
1165530195 19:36392812-36392834 TGAGAAACCCTATGAATGTAAGG - Exonic
1165530233 19:36393232-36393254 TGAGAAACCCTATGAATGTAAGG - Exonic
1165530242 19:36393316-36393338 TGAGAAACCCTATGAATGTAAGG - Exonic
1165536275 19:36449039-36449061 TGAGAAACCCTATGAATATAGGG - Exonic
1165536313 19:36449459-36449481 TGAGAAACCCTATGAATGTAAGG - Exonic
1165556656 19:36638844-36638866 TGAGAAACCCTATGAATGTAAGG - Exonic
1165556687 19:36639180-36639202 TGAGAAACCCTATGAATGTCGGG - Exonic
1165568018 19:36749011-36749033 TGAGAAACCCTATGAATGTCCGG - Exonic
1165582338 19:36877928-36877950 TGAGAAACCCTATGAATGTAAGG + Exonic
1165582359 19:36878096-36878118 TGAGAAACCCTATGAATGTAAGG + Exonic
1165583574 19:36892061-36892083 TGAGAAACCCTATGAATGTAAGG - Exonic
1165589080 19:36950479-36950501 TGAGAAACCCTATGAATGTAAGG + Exonic
1165597058 19:37018299-37018321 CGAGGTTTCATATGAATTTCAGG - Intronic
1165605554 19:37100750-37100772 TGTGGTTCCATATGAATTTTAGG + Intronic
1165608396 19:37127900-37127922 TGAGAAACCCTATGAATGTAAGG + Exonic
1165608446 19:37128404-37128426 TGAGAAACCCTATGAATGTAAGG + Exonic
1165620538 19:37243154-37243176 TGAGAAACCCTATGAATGTAAGG + Exonic
1165643653 19:37413418-37413440 TGAGAAACCCTATGAATGTAAGG - Exonic
1165669976 19:37668536-37668558 TGAGAAACCCTTTGAATGTCAGG - Exonic
1165669989 19:37668698-37668720 TGAGAAACCCTATGAGTTTAAGG - Exonic
1165670062 19:37669872-37669894 TGAGAAACCCTATGAATGTCTGG - Exonic
1165684134 19:37803521-37803543 TGAGAAACCCTATGAATGTAAGG + Intronic
1166019637 19:40014665-40014687 TGAGAAACCCTATGAATGTAAGG + Exonic
1166019647 19:40014749-40014771 TGAGATTCCCTATGAATGTAAGG + Exonic
1166019660 19:40014917-40014939 TGAGAAACCCTATGAATGTAAGG + Exonic
1166019699 19:40015421-40015443 TGAGCTTCCATATGAATGTAAGG + Exonic
1166021427 19:40034088-40034110 TGAGAAACCCTATGAATGTAAGG - Exonic
1166021464 19:40034506-40034528 TGAGAAACCCTATGAATGTAAGG - Exonic
1166021536 19:40035262-40035284 TGAGAAGCCCTATGAATGTAAGG - Exonic
1166025014 19:40074929-40074951 TGAGAAGCCCTATGAATGTAAGG - Exonic
1166265414 19:41680417-41680439 TGAGACTCTATATGAATTTTAGG - Intronic
1166272551 19:41724456-41724478 TGAGATTCCATATGAATTTCAGG + Intronic
1166414669 19:42586243-42586265 TGAAATTCCATATGAACTTTAGG - Intronic
1166419263 19:42623186-42623208 TGAGACTCCATATGAATTTTAGG - Intronic
1166424604 19:42665499-42665521 TGAGATTCCATATAAATTTTAGG + Intronic
1166463585 19:43012786-43012808 TGAGATTCAATATAAATTTTAGG - Intronic
1166576762 19:43848134-43848156 TGAGAAACCCTATGAATGTAAGG + Exonic
1167187926 19:47960620-47960642 TGAGATTCCGTATGAATTTTAGG - Intergenic
1167371665 19:49086108-49086130 AGAGGTTCCCTGGGAATTTCTGG - Intronic
1167786494 19:51642077-51642099 TGAGATTTCCTTTGAATTCACGG - Intronic
1168268101 19:55233858-55233880 TGAGATTCCATATGAATTTTAGG - Intronic
1168463685 19:56584474-56584496 TGTGCTTCCATATGAATTTTAGG - Intronic
1202633805 1_KI270706v1_random:24883-24905 GGAGATTCCATATGAGTTTTAGG + Intergenic
1202652077 1_KI270707v1_random:15174-15196 GGGGATTCCATATGAATTTTAGG - Intergenic
1202660057 1_KI270708v1_random:60539-60561 GGAGATTCCATATGAATTTTAGG + Intergenic
924996880 2:369585-369607 TACGATTCCATATGAATTTTAGG + Intergenic
925322156 2:2981095-2981117 TTTGATTCCATATGAATTTTAGG - Intergenic
925354699 2:3230836-3230858 TGGGGTTCCATATGAATTTCAGG + Intronic
925506472 2:4570306-4570328 TAAGATTCCATATGAATTTTAGG + Intergenic
925677341 2:6377898-6377920 TTTGATTCCATATGAATTTTAGG - Intergenic
925796314 2:7547246-7547268 TGAGATTCCATATGAATTTGAGG + Intergenic
925839971 2:7982122-7982144 TGTGGTTCCATATGAATTTTAGG - Intergenic
926130276 2:10298819-10298841 TGAGATTCCATATGAATTTTAGG - Intergenic
927098648 2:19768924-19768946 TGAAATTTCATATGAATTTAAGG - Intergenic
927116316 2:19905636-19905658 TGTAATTCCATATGAATTTGAGG - Intergenic
927803808 2:26126615-26126637 TTAGATTCCATATGAATTTTTGG + Intronic
928004572 2:27552575-27552597 TGTAATTCCATATGAATTTTAGG + Intronic
928589180 2:32796650-32796672 TGAGATTCCATTTGAATTTTAGG - Intronic
928838075 2:35571036-35571058 TGTGGTTCCATATGAATTTTAGG + Intergenic
929051993 2:37845526-37845548 TGAGTTTCCCTATGATCATCTGG + Intergenic
929064035 2:37954692-37954714 TGGAATTCCAAATGAATTTCAGG + Intronic
929324178 2:40586495-40586517 TGAGTTTTCATATGACTTTCAGG + Intronic
929528587 2:42729782-42729804 TGTGATTCCATATAAATTTTAGG + Intronic
930429513 2:51256191-51256213 TTTTATTCCATATGAATTTCAGG - Intergenic
930499918 2:52201591-52201613 TGTGGTTCCATATGAATTTTAGG - Intergenic
931223513 2:60309495-60309517 TCAAATTCCCAAAGAATTTCTGG - Intergenic
931479634 2:62628054-62628076 TGAGGTTCCATATGAATTTTAGG + Intergenic
932085926 2:68760825-68760847 TGAGTTTCCATATGAACTTTAGG - Intronic
932382181 2:71294649-71294671 TGGGATTCCATATGAATTTTAGG + Intronic
932519883 2:72399933-72399955 TTAGGTTCCATATGAATTTTAGG - Intronic
932560781 2:72866809-72866831 TAAAATTCCATATGAATTTTGGG - Intergenic
932831643 2:74996166-74996188 TGAGACTGTCTCTGAATTTCTGG - Intergenic
933156035 2:78975915-78975937 TGAAATTCTATATGAATTTTAGG + Intergenic
933189344 2:79315871-79315893 TTAGAATCCTTATGAATTGCTGG - Intronic
933305648 2:80594993-80595015 TGAGAGTCCATGTGAATTTTAGG + Intronic
933332783 2:80915643-80915665 TGTGATTCCATATAAATTTTGGG + Intergenic
933422885 2:82074356-82074378 TGTGATTCCATAAGAATTTTAGG + Intergenic
934458410 2:94194857-94194879 TGCGGTTCCATATGAGTTTCAGG - Intergenic
934881744 2:97987958-97987980 TGAGATTCTGTATGAATTTTAGG - Intronic
934911671 2:98262776-98262798 TGAAATTCCATATAAATTTTAGG + Intronic
934990705 2:98919317-98919339 TTAGGTTCCTTATTAATTTCAGG + Intronic
935001074 2:99016152-99016174 TGAGGTTCCATATGAATTTTAGG - Intronic
935004125 2:99054029-99054051 TGTGGTTCCATATGAATTTTAGG - Intronic
935290395 2:101605602-101605624 TGTGGTTCCATATGAATTTTAGG - Intergenic
935378796 2:102428190-102428212 TGTGGTTCCATATGAATTTAAGG + Intronic
935433308 2:103001339-103001361 TGTGATTCCACATGAATTTTAGG - Intergenic
935436454 2:103040274-103040296 TGCAATTCCCTATGAATTTGAGG + Intergenic
935590249 2:104841792-104841814 TTAGAATCCCTCTGAATCTCAGG + Intergenic
935683328 2:105658254-105658276 TGAGATTCCATATGAATCTTAGG - Intergenic
935708675 2:105878283-105878305 TGGGACTTCGTATGAATTTCAGG - Intronic
935752258 2:106246299-106246321 TGTGGTTCCATATGAATTTTAGG - Intergenic
935912669 2:107913842-107913864 TGTGGTTCCATATGAATTTTAGG - Intergenic
936000817 2:108828358-108828380 TCAGATTCCATATCAATTTTAGG - Intronic
936239476 2:110774820-110774842 TGAGATTCCATGTGAATTTTAGG - Intronic
936588343 2:113778698-113778720 TGTGGTTCCATATGAATTTTAGG - Intergenic
936936455 2:117843158-117843180 TGAGATTCCATATAAATTTTAGG + Intergenic
937425027 2:121791539-121791561 AGAGATTTCCTGTAAATTTCTGG + Intergenic
937591731 2:123621544-123621566 TGTGATTCCATATATATTTCAGG - Intergenic
937650266 2:124311607-124311629 TCAAATTTCCTATGAATTTTGGG + Intronic
937754705 2:125522681-125522703 TGAATTTCCATATGAATTTTAGG - Intergenic
937874635 2:126812938-126812960 TGCAATTCCATATGAATTTGAGG + Intergenic
937899672 2:127009498-127009520 TGAGATTCCATATGAATTTCAGG + Intergenic
938068831 2:128296866-128296888 TGAAATTTCATATGAATTTTAGG - Intronic
938183864 2:129210388-129210410 TGTGCTTCCATCTGAATTTCTGG - Intergenic
938372098 2:130776445-130776467 TGAGATTCCATATGAATTTTGGG - Intergenic
938563900 2:132499560-132499582 TTTGATTCCATATGAATTTTAGG + Intronic
938691735 2:133797479-133797501 TGTGGTTCCATATGAATTTTAGG + Intergenic
938844263 2:135192540-135192562 TGAGATTCCATATAAATTTTAGG - Intronic
939195869 2:138970882-138970904 TGAAATTCCATATGAATTTGAGG + Intergenic
939998719 2:148945811-148945833 TGAGATTTCATATAAATTTTAGG + Intronic
940304662 2:152212617-152212639 TGAGTTTCCATATAAATTTTAGG + Intergenic
940344296 2:152613389-152613411 TGAGATTCACAATGAATAACAGG - Intronic
940364487 2:152832799-152832821 TGAAATTCCATATGAATTTTAGG + Intergenic
940524455 2:154794649-154794671 TGAGATTCATTATGACTTTGAGG - Intronic
940551676 2:155166319-155166341 TGAGATTCCCCACCAGTTTCTGG + Intergenic
940630144 2:156228568-156228590 TGAGTTTCCATATGAATCTTAGG - Intergenic
940749339 2:157607458-157607480 TTTGATTCCATATGAATTTTAGG + Intronic
940876692 2:158904826-158904848 TCAGAATTCCTATAAATTTCAGG + Intergenic
941369714 2:164649337-164649359 TGAGATTCCATATGAATTTTAGG + Intergenic
941497246 2:166221307-166221329 TGTGGTTCCATATGAATTTTAGG - Intronic
941705461 2:168654052-168654074 TGAGATTCCTCATGCATCTCAGG + Intronic
941742094 2:169046123-169046145 TGAGATTTCATATAAATTTTAGG - Intergenic
942056344 2:172187146-172187168 TGATATTTCATATGAATTTTAGG + Intergenic
942272731 2:174293217-174293239 TGTGGTTCCATATGAATTTTAGG + Intergenic
942999423 2:182306458-182306480 TGTGGTTCCATATGAATTTTTGG - Intronic
943124379 2:183778414-183778436 TGATATTTCCTATGTTTTTCAGG + Intergenic
943391661 2:187277256-187277278 TATGATTCGATATGAATTTCAGG - Intergenic
943546760 2:189289980-189290002 TGTGCTTCCTTATGAATTTTAGG - Intergenic
943601221 2:189923383-189923405 TGAGATTCCCAATGAATACACGG - Intronic
944812095 2:203337637-203337659 TGTGGTTTCCTATGAATTTTAGG - Intronic
944974114 2:205028061-205028083 TGTGGTTCCATATGAATTTTAGG + Intronic
945114313 2:206396267-206396289 TAAGATTCCCTATCTCTTTCGGG - Intergenic
945215200 2:207426200-207426222 TGAATTTCCATATGAATTTTAGG - Intergenic
945289634 2:208114586-208114608 TGAGATTCCAGATGAATTTTAGG - Intergenic
945315331 2:208364659-208364681 TGAGATTCCATATCAATTTTAGG + Intronic
945359316 2:208877828-208877850 TGTGGTTCCATATAAATTTCAGG + Intergenic
945431899 2:209773893-209773915 TAAGATTCCCTTAGAATCTCAGG - Intronic
945521108 2:210828499-210828521 TTGGGTTCCATATGAATTTCAGG + Intergenic
945550597 2:211217440-211217462 TTTGATTCCATATGAATTTTAGG - Intergenic
945758366 2:213879140-213879162 TTTGATTCCATATGAATTTTAGG + Intronic
945843825 2:214919379-214919401 TGAGAGTCTGTATGAATTTTAGG - Intergenic
946390492 2:219413073-219413095 TGAAATTCCTTATGAATTTTAGG - Intergenic
947090265 2:226502339-226502361 TGTGATTCCATATGAATTTTAGG - Intergenic
947290085 2:228563271-228563293 TGATATTACCTATAAATTTAAGG + Intergenic
947475156 2:230439287-230439309 TTTGATTCCATATGAATTTTAGG + Intronic
947479729 2:230488053-230488075 TGACATTCCTTATCAATTTAAGG + Intronic
947678013 2:232002357-232002379 TGTGATTCTATATGAATTTTAGG + Intronic
948105948 2:235413714-235413736 TGAGAGTCCCAATGAATTCCAGG + Intergenic
948739677 2:240035580-240035602 TGTGATTCCATATAAATTTTAGG + Intergenic
1169393498 20:5209899-5209921 TGTGGTTCCATATGAATTTTAGG - Intergenic
1169396219 20:5232263-5232285 TGAGATCCCATATAAATTTTAGG - Intergenic
1169528469 20:6456622-6456644 TGTGGTTCCATATGAATTTTAGG - Intergenic
1169625199 20:7559322-7559344 TTTGATTCCTTATGAATTTTAGG + Intergenic
1169791831 20:9418658-9418680 TGAGTTTCTATATGAATTTTAGG + Intronic
1169810010 20:9600338-9600360 TGGGATTCCATATGAATTTTAGG + Intronic
1169833154 20:9847554-9847576 TGAGATTCCATATAAATTTTAGG - Intergenic
1169933166 20:10855759-10855781 TGTGGTTCCATATGAATTTTAGG - Intergenic
1170175371 20:13463021-13463043 TGAGATTCCATGTAAATTTTTGG - Intronic
1170228300 20:14016846-14016868 TGAGATTCCAAATGAATTTTAGG + Intronic
1170319984 20:15084917-15084939 TGAGTTTCCATATGAATTTTAGG - Intronic
1170777861 20:19393862-19393884 TAAGATTCTATATGAATTTTAGG - Intronic
1170995462 20:21352026-21352048 TGAGATTTCACATGAATTTTAGG + Intronic
1171100324 20:22377082-22377104 AATGATTCCCCATGAATTTCAGG + Intergenic
1171187671 20:23134545-23134567 TAAAATTCCATATGAATTTTAGG - Intergenic
1171507094 20:25646120-25646142 TGAGATTTCATATGAATTTTAGG + Intergenic
1171726813 20:28630790-28630812 TGTGATTCTATATGAATTTTAGG - Intergenic
1171790881 20:29524055-29524077 TGTGATTCTATATGAATTTTAGG - Intergenic
1171856825 20:30352778-30352800 TGTGATTCTATATGAATTTTAGG + Intergenic
1172378365 20:34465367-34465389 TGAGATTCCATATGAATTTTAGG + Intronic
1172813155 20:37665270-37665292 TGCAATTCCATATGAATTTTAGG + Intergenic
1172879054 20:38186151-38186173 TGCAATTCCATATGAATTTTAGG + Intergenic
1173604050 20:44317152-44317174 TGTGGTTCCATATGAATTTTAGG - Intergenic
1174341277 20:49897723-49897745 TGAGATCCCATATGAATTTTAGG - Intergenic
1174401118 20:50276513-50276535 TGAGATTCCAAATGAACATCGGG + Intergenic
1174653320 20:52148241-52148263 TGAGATTCCCAAAGAAGATCTGG - Intronic
1175170654 20:57078388-57078410 TGAGATTCCACAGGAATTTTAGG + Intergenic
1175701864 20:61144749-61144771 TGTGGTTCCATATGAATTTTAGG + Intergenic
1176043182 20:63077133-63077155 TGAGATTCCATAGAAATTTTAGG + Intergenic
1176313331 21:5217122-5217144 TGTGATTCTATATGAATTTTAGG - Intergenic
1176627966 21:9110467-9110489 GGAGATTCCATATGAATTTTAGG - Intergenic
1176646019 21:9350742-9350764 GGAGATTCCATATGAGTTTTAGG + Intergenic
1176898273 21:14408954-14408976 TGTGATTCCATATAAATTTTAGG + Intergenic
1177662540 21:24104898-24104920 TGCGATTCCTTATAAATTTTAGG - Intergenic
1177747652 21:25239774-25239796 AGAGATTCTATATGAATTTTAGG - Intergenic
1179113832 21:38471565-38471587 TGATATTCACTATGAATGTGTGG - Intronic
1179434822 21:41353309-41353331 TGAATTTCCATATGAATTTTAGG - Intronic
1179777952 21:43679623-43679645 TTTGATTCCATATGAATTTTAGG + Intronic
1180178311 21:46101893-46101915 TGAGATTCCATCTAAATTTTAGG + Intronic
1180327533 22:11444121-11444143 GGAGATTCCATATGAATCTTAGG + Intergenic
1180379184 22:12122945-12122967 ATAGATTCCATATGAATTTTAGG + Intergenic
1180418349 22:12790381-12790403 GGAGATTCCATATGAATTTTAGG - Intergenic
1180721514 22:17912326-17912348 TGAGATTCCATGTAAATTTTAGG + Intronic
1180745082 22:18082693-18082715 TGTGGTTCCATACGAATTTCAGG + Intronic
1180906456 22:19415894-19415916 TAAGATTCCATGTGAATTTTGGG - Intronic
1180977706 22:19858738-19858760 ACAGATTCCATATGAATTTTAGG + Intergenic
1181292172 22:21804323-21804345 TGAATTTCCATATGAATTTTGGG + Intronic
1182181449 22:28353345-28353367 TGAGATTCCATATGAGTTTTAGG - Intronic
1183757546 22:39783401-39783423 TGTGATTCCATATAAATTTTAGG - Intronic
1184365077 22:44045906-44045928 CGAGATTCCGTATGAGTTTTAGG + Intronic
1185251986 22:49807279-49807301 TGAGTTTCCATATGAATTTTAGG - Intronic
1185283315 22:49985692-49985714 TGAGATTCCAGGTGAATTTTAGG + Intergenic
1185364029 22:50427387-50427409 TGAGATTCTGTATGAATTTGGGG + Intronic
949442717 3:4100190-4100212 TGTGGTTCCATATGAATTTTAGG - Intronic
949935796 3:9114616-9114638 TGAGCTCCCCTTTGACTTTCTGG + Intronic
950245460 3:11412672-11412694 TAAGATTACATATGAATTTTAGG + Intronic
950307407 3:11927136-11927158 TGAATTTCCATATGAATTTTAGG + Intergenic
950339047 3:12225331-12225353 TGTGATTCCATATAAATTTTAGG - Intergenic
950999478 3:17541153-17541175 TCAGTTTCCATATGAATTTAAGG + Intronic
951348739 3:21578823-21578845 TGTGGTTCCATATGAATTTCAGG + Intronic
951759625 3:26130858-26130880 TGAGATGCCATGTGAATTTTAGG + Intergenic
952026982 3:29094882-29094904 TGTGCTTCCATATGAATTTTAGG + Intergenic
952060699 3:29505572-29505594 TGTGGTTCCATATGAATTTTAGG + Intronic
952251330 3:31658591-31658613 TAAGATTCCATGTGAATTTTAGG - Exonic
952415641 3:33088787-33088809 TGAGATTCCATATGAATTTTAGG - Intronic
952442701 3:33348499-33348521 TGTGATTCCGTATAAATTTTAGG + Intronic
952461474 3:33530980-33531002 TAAGATTCCTTATGAATTTTAGG - Intronic
952603712 3:35117198-35117220 TGAGATTCCATATGAATTTTTGG + Intergenic
952609473 3:35190746-35190768 TGGGATTCCTCAAGAATTTCTGG - Intergenic
952735381 3:36685597-36685619 TGAGATTCCATAGAAATTTTGGG - Intergenic
952984477 3:38765709-38765731 TTTGGTTCCCTATGAATTTTAGG + Intronic
953037089 3:39221891-39221913 TGAGTTTCCATATAATTTTCAGG - Intergenic
953283830 3:41585167-41585189 TGAGAATTCATATGAATTTTAGG - Intronic
953318578 3:41951343-41951365 TGAGATTCTATATGAATTTTCGG - Intronic
953638500 3:44684134-44684156 TGAGAAACCCTATGAATGCCAGG - Intergenic
953764391 3:45725176-45725198 TGAGATTGCTTATGAATTTTAGG + Intronic
953812594 3:46127174-46127196 TGAGAGTCCATATGAATTTTAGG - Intergenic
953833174 3:46320132-46320154 TGATAGTCCATATGAATTTCAGG + Intergenic
953900831 3:46842307-46842329 TCAGATTCCAAATGAATTTTAGG - Intergenic
954057751 3:48041763-48041785 TGAATTTCCATATGAATTTTAGG - Intronic
954207893 3:49074113-49074135 TCAGATTACGTATGGATTTCTGG - Intronic
954470796 3:50693215-50693237 TGAGATTCCATATGAATTTCAGG + Intronic
954601185 3:51871039-51871061 TTAGATTCCATATAAATTTTAGG - Intergenic
955045559 3:55356480-55356502 CGAGATTCCATATGAATTTTGGG + Intergenic
955172052 3:56576016-56576038 TGAGATTCCATATGAATTTTAGG + Intronic
956235390 3:67064205-67064227 TCAGATTCCTTATGCATATCGGG - Intergenic
956383323 3:68688776-68688798 AGAGATTACATATGAATTTTAGG + Intergenic
956465306 3:69514864-69514886 TGAGAATCCATAGGAATTTTAGG - Intronic
956550821 3:70457226-70457248 TGTGATTCCATATAAATTTTAGG - Intergenic
956784238 3:72629028-72629050 TTATATTCCCTATGAAATTATGG - Intergenic
956940196 3:74151380-74151402 TGAGATTCGATGTGAATTTTTGG - Intergenic
956977974 3:74603818-74603840 TGTGATTCCATATAAATTTTAGG - Intergenic
957066984 3:75532107-75532129 TCTGGTTCCATATGAATTTCAGG - Intergenic
957094176 3:75762707-75762729 GGAGATTCCATATGAGTTTTAGG - Intronic
957881796 3:86224755-86224777 TGAGATTCCATATGAATTTTAGG - Intergenic
958010620 3:87874647-87874669 TGAGATTCCATATTAATTTTAGG - Intergenic
958263060 3:91404662-91404684 TGCAATTCCATATGAATTTGAGG - Intergenic
958507571 3:94999777-94999799 TGTGCTTCCATATGAATTTTAGG - Intergenic
959113997 3:102154388-102154410 TGTGATTCCATATAAATTTTGGG - Intronic
959491529 3:106995023-106995045 TGTGATTCCACATGAATTTTAGG - Intergenic
959948980 3:112157509-112157531 TGTGGTTCCCTATGGATTTTAGG + Intronic
960188141 3:114669516-114669538 TAATATTCCCTTTGAATTCCAGG + Intronic
960329053 3:116335364-116335386 TGATATTCCATATAAATTTTAGG - Intronic
960410745 3:117320902-117320924 TGAGATTCCATATAAATTTTAGG - Intergenic
960483403 3:118221439-118221461 TGAGATTCCATATGAATTTTAGG - Intergenic
960785182 3:121364440-121364462 TGAGATTCCAGATGAAGTTAAGG + Intronic
961251276 3:125508220-125508242 TGAGATTCCATATGACTCTTAGG - Intronic
961286174 3:125805941-125805963 TGTGGTTCCATATGAATTTCAGG + Intergenic
961401464 3:126648374-126648396 TGAAATTCCATATGAATTTTAGG - Intronic
961900582 3:130207001-130207023 TGTGGTTCCATATGAATTTCAGG - Intergenic
962030336 3:131593153-131593175 TGTGGTTCCATATGAATTTTAGG + Intronic
962062675 3:131947177-131947199 TGCAATTCCATATGAATTTGAGG + Intronic
962288843 3:134112848-134112870 TGAGATTCTGTATGAATTTTAGG - Intronic
962516719 3:136159099-136159121 TGTGATTCCATATGAATTTTAGG - Intronic
962565495 3:136654632-136654654 TGAGATTCCATATAAATTTTAGG - Intronic
962707152 3:138055063-138055085 TGAGATTCCATATGAATTTTAGG - Intergenic
962838460 3:139211174-139211196 TGAGATTCTATATGAATTTTAGG + Intronic
962860669 3:139397451-139397473 TGTGATCCCCTATAAAGTTCTGG - Intergenic
963272268 3:143297525-143297547 TGTGGTTCCATATGAATTTTGGG + Intronic
963446168 3:145411246-145411268 TTAGAATCCATATGAATTTTAGG - Intergenic
963471708 3:145749427-145749449 TGAGGACCCCTCTGAATTTCTGG + Intergenic
963636359 3:147801910-147801932 TGAGATTTCATATGAATTTTAGG + Intergenic
963692677 3:148524644-148524666 TGTGATTCCATATAAATTTTAGG - Intergenic
963840579 3:150101290-150101312 TGAGATTCCATATAAATTTTAGG + Intergenic
964343568 3:155733218-155733240 TGTGGTTCCATATGAATTTTAGG - Intronic
964349572 3:155789619-155789641 TGTGATTCCACATGAATTTGAGG - Intronic
964565441 3:158046199-158046221 TGTGATTCCATATAAATTTTAGG - Intergenic
965876508 3:173329029-173329051 TGAGATTCCATCTGAATTTTAGG + Intergenic
965979477 3:174669728-174669750 TGAGATTACATATGAATTGTAGG + Intronic
966218233 3:177524795-177524817 TGAGTTTCACGATGTATTTCAGG - Intergenic
966229523 3:177636358-177636380 TTTGGTTCCCTATGAATTTTAGG + Intergenic
966707165 3:182929173-182929195 TGATATTCCATATGAATTTTAGG - Intergenic
966841577 3:184093684-184093706 TGACATTCCGTATGAATTTTAGG - Intergenic
967006544 3:185388685-185388707 TGTGGTTCCGTATGAATTTTAGG - Intronic
967349708 3:188499599-188499621 TCATATTCCATATGAATTTTAGG + Intronic
967443348 3:189535079-189535101 TGAGTTTCCCTATGATGGTCAGG - Intergenic
968022847 3:195409926-195409948 TGAGATTTCATATGAATTTTAGG - Intronic
968109372 3:196031337-196031359 TGTGGTTCCATATGAATTTTAGG - Intronic
1202740866 3_GL000221v1_random:54321-54343 GGAGATTCCATATGAGTTTTAGG - Intergenic
968389657 4:179373-179395 TGTGATTACATATGAATTTTAGG + Intergenic
968544389 4:1191116-1191138 TGCAATTCCGTATGAATTTTAGG - Intronic
968557875 4:1258022-1258044 TGAGATTCTATATGAGTTTTAGG + Intergenic
968604590 4:1527561-1527583 TGAGATTCCATATGAATTTTAGG + Intergenic
968792585 4:2677785-2677807 TGAGATTCTATATGAATTTAGGG + Intronic
969011571 4:4068173-4068195 TGTGGTTCCATATGAATTTCAGG - Intergenic
969039089 4:4280427-4280449 TGAGATTCCCTGTGAGTTTTAGG - Intronic
969165280 4:5304168-5304190 TTTGATTCCATATGAATTTTAGG + Intronic
969372074 4:6738850-6738872 TGAGATTCCACATAAATTTTAGG + Intergenic
969742502 4:9041711-9041733 TGTGGTTCCATATGAATTTCAGG + Intergenic
969801888 4:9573889-9573911 TATGCTTCCATATGAATTTCAGG + Intergenic
970058529 4:12002823-12002845 TGAGAGTCCCTATAAATGTTAGG - Intergenic
970391876 4:15620431-15620453 TGAGATTCCATCAGAATTTTAGG - Intronic
970648712 4:18153824-18153846 TGTGGTTCCATATGAATTTTAGG - Intergenic
970707733 4:18824987-18825009 TGAGAATCCATATTAATTTTAGG - Intergenic
970773460 4:19643415-19643437 TTTGATTCCATATGAATTTTAGG + Intergenic
971005304 4:22367680-22367702 TGAGATTCCATATGAATTTTAGG - Intronic
971430439 4:26560134-26560156 GGAGATTCCCTATGAATTTTAGG + Intergenic
971509112 4:27401815-27401837 TGTGGTTCCATATGAATTTTAGG - Intergenic
971818728 4:31524342-31524364 TGTGGTTCCATATGAATTTTAGG + Intergenic
971903019 4:32686906-32686928 TGAGATTCCAGATGAATATTAGG + Intergenic
971976987 4:33703044-33703066 TGTGATTCCAAATGAATTTGGGG + Intergenic
972052143 4:34750566-34750588 TGTGGTTCCGTATGAATTTTAGG - Intergenic
972521148 4:39858238-39858260 TGATATTTCCTGTGAATTTTAGG - Intronic
972807046 4:42539454-42539476 TTTGATTCCATATGAATTTTAGG - Intronic
972845086 4:42978298-42978320 TGTCATTCCATATGAATTTTAGG + Intronic
972955497 4:44385223-44385245 TGAGATTCCATCTGAATTTTAGG - Intronic
973020787 4:45203818-45203840 TTTGATTCCATATGAATTTTAGG + Intergenic
973182337 4:47284460-47284482 TGAGAATAAGTATGAATTTCGGG - Intronic
973215171 4:47659847-47659869 TGTGATTCCATATGAATTTTAGG - Intronic
973268559 4:48236091-48236113 AGAGATAGCCTATGACTTTCAGG + Intronic
973363436 4:49186897-49186919 GGAGATTCCATATGAATTTTAGG + Intergenic
973397658 4:49609961-49609983 GGAGATTCCATATGAATTTTAGG - Intergenic
973906138 4:55533126-55533148 TGAGATTCTGTATGAATTTTAGG - Intronic
973977553 4:56278159-56278181 TGCAATTCCATATGAATTTTAGG - Intronic
974285453 4:59860233-59860255 TGTGGTTCCATATGAATTTCAGG + Intergenic
974315590 4:60275739-60275761 TGAGATTCCATACCAATTTTAGG + Intergenic
974322805 4:60373806-60373828 TGAGATTCCATAGGAATTCTAGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974564426 4:63565407-63565429 TGAGACTCACTATGCACTTCTGG - Intergenic
974617501 4:64308004-64308026 TGAGAATCCCTCTGCCTTTCTGG + Intronic
974974108 4:68868321-68868343 TTTTATACCCTATGAATTTCAGG - Intergenic
975128586 4:70809644-70809666 TGACATTCTGTATGAATTTTAGG - Intergenic
975419717 4:74148648-74148670 TAATATTCCATATGAATTTTAGG + Intronic
975833438 4:78394694-78394716 TGTGGTTCCATATGAATTTTAGG + Intronic
976535781 4:86214914-86214936 TGAGACTTCATATGAATTTTAGG - Intronic
976707109 4:88030511-88030533 TGCCATTCCCTATAAATATCTGG + Intronic
977073998 4:92430596-92430618 TGTGATTCTCTATACATTTCAGG + Intronic
977280657 4:95035770-95035792 TGTGGTTCCATATGAATTTTAGG + Intronic
977550818 4:98441125-98441147 TGAGATTCCATATGAATTTTAGG + Intronic
977641790 4:99365715-99365737 TGTGATTCCATATAAATTTTAGG + Intergenic
977829623 4:101575494-101575516 TGTGTTTCCATATGAATTTTAGG + Intronic
978207494 4:106095520-106095542 TGACCTTCCCTTTGAAGTTCTGG + Exonic
978212928 4:106159779-106159801 TGAGATTCCATATGAATTTTGGG - Intronic
978298005 4:107231485-107231507 TGGCATTCCATATGAATTTTAGG - Intronic
978359933 4:107920685-107920707 TCAGATTCCATATGAATTTTTGG - Intergenic
978757386 4:112317703-112317725 TGAGATTCTATATAAATTTTAGG + Intronic
978982333 4:114962810-114962832 TGAATTTCCATATGAATTTTAGG - Intronic
979142317 4:117192716-117192738 TGTGATTCCATATAAATTTCAGG + Intergenic
979413835 4:120411887-120411909 TGTGATTCCATATAAATTTTAGG - Intergenic
979430660 4:120625572-120625594 TGTCATTCCATATGAATTTTAGG - Intergenic
979493231 4:121354199-121354221 TGTGGTTCCATATGAATTTTAGG + Intronic
979651247 4:123134572-123134594 TGTGATTCCATATGAATTTTAGG + Intronic
980759180 4:137205987-137206009 TGTGATTCCATGTGAATTTCAGG + Intergenic
981180701 4:141740583-141740605 TGCGATTCCTTATGAATTTGGGG - Intergenic
981705088 4:147650637-147650659 TGAGATTCCATATAAATTTTAGG - Intronic
982063914 4:151634413-151634435 TGAGATTTCATATAAATTTTGGG - Intronic
982241265 4:153301970-153301992 TGTGATTCCATACGAATTTTAGG + Intronic
982757091 4:159233996-159234018 TGAATTTCCATATGAATTTTAGG + Intronic
982790000 4:159579973-159579995 TGTGGTTCCATATGAATTTGAGG + Intergenic
982845099 4:160242472-160242494 TTTTATTCCATATGAATTTCAGG + Intergenic
982947693 4:161647477-161647499 TGTGGTTCCATATAAATTTCAGG + Intronic
983036211 4:162869301-162869323 TTTGATTCCATATGAATTTTAGG - Intergenic
983113807 4:163786737-163786759 TGAGATTCCATCTAAATTTTAGG - Intronic
983775321 4:171598926-171598948 TGTGATTTCCTATTTATTTCAGG - Intergenic
983886033 4:172981687-172981709 TGAGATTCCATAGGAATTTAAGG + Intronic
983887818 4:173000555-173000577 TGAGATTCCATATAAATTTTAGG - Intronic
984093087 4:175399617-175399639 TGTGAATCCATATGAATTTTAGG - Intergenic
984116603 4:175689200-175689222 TGTGATTCCATAAGAATTTTAGG + Intronic
984148399 4:176093337-176093359 TGTGGTTCCATATAAATTTCAGG - Intronic
984337544 4:178412448-178412470 TGAGATTTCATATGAATATTAGG - Intergenic
984627779 4:182026951-182026973 TGTGATTCCATATAAATTTTAGG + Intergenic
984724339 4:183006105-183006127 TGAAATTTCATATGAATTTTAGG - Intergenic
984730299 4:183062143-183062165 TGAGATTCTATATGAATTTGAGG + Intergenic
985433833 4:189908179-189908201 TGTGATTCTATATGAATTTTAGG + Intergenic
1202760803 4_GL000008v2_random:108426-108448 ATAGATTCCATATGAATTTTAGG + Intergenic
985485873 5:148725-148747 TGAGATTCCCTATGAATTTCAGG - Intronic
986090812 5:4502876-4502898 TGGGATTCCATATGAATTGTAGG + Intergenic
986966966 5:13285330-13285352 TGAGATTCCATGTGAGTTTTAGG + Intergenic
987106183 5:14641853-14641875 TTAGATTCCATATGAATTTTAGG + Intergenic
987161907 5:15153556-15153578 CGTGGTTCCCTATGAATTTTAGG - Intergenic
987863806 5:23516001-23516023 AGAGATTCTATATGAATTTTTGG + Intronic
988072889 5:26317188-26317210 TTTGGTTCCATATGAATTTCAGG + Intergenic
988576210 5:32427640-32427662 TGAGATTCCACAGGAATTTTAGG - Intronic
988624435 5:32857612-32857634 TAAGCTTCCATCTGAATTTCAGG + Intergenic
989129357 5:38090690-38090712 TGAGATTCCCTCACAATTTGTGG - Intergenic
989471723 5:41827291-41827313 TGAGTCTCTCTATGACTTTCTGG - Intronic
989974687 5:50570699-50570721 TGTGATTCCATATAAATTTTAGG - Intergenic
990275293 5:54189308-54189330 TGTGATTCTATATGAATTTTAGG - Intronic
990344459 5:54857698-54857720 TGAGAAACTCTGTGAATTTCAGG + Intergenic
990602479 5:57373796-57373818 TTTGATTCCATATGAATTTTAGG - Intergenic
990854153 5:60244449-60244471 TGTGATTCCATATAAATTTTAGG - Intronic
990920174 5:60955557-60955579 TGTAATTCCATATGAATTTTAGG + Intronic
991154529 5:63415804-63415826 TGGGATTCACAATGAATTCCTGG + Intergenic
991239129 5:64437250-64437272 TGTGATTCCATATGAATTTATGG - Intergenic
991319726 5:65358528-65358550 TGTGGTTCCATATGAATTTTAGG - Intronic
991523257 5:67525569-67525591 TGAAATTCCATATGAATTTTAGG - Intergenic
991545535 5:67778141-67778163 TGTGGTTCCATATGAATTTGAGG + Intergenic
991565594 5:68001074-68001096 TGACATTCCCTTTGACTTCCTGG - Intergenic
991976315 5:72186721-72186743 TGAAAATCTCTATGAAGTTCTGG - Exonic
992494729 5:77281407-77281429 TAAGATTCATTTTGAATTTCTGG - Intronic
992599480 5:78383922-78383944 TTTGGTTCCATATGAATTTCAGG + Intronic
992802465 5:80305984-80306006 TGAATTTCCATATGAATTTTAGG + Intergenic
992945673 5:81807614-81807636 TGTGGTTCCCTGTGAATTTTAGG - Intergenic
993136968 5:83981140-83981162 TGAATTTCCATATGAATTTCAGG - Intronic
993204073 5:84857126-84857148 TGAGATTTCATATAAATTTTAGG + Intergenic
993326974 5:86552528-86552550 TGTGGTTCCATATGAATTTTAGG - Intergenic
993347952 5:86808712-86808734 TGTGGTTCCATATGAATTTTAGG - Intergenic
993582752 5:89683196-89683218 TGTGGTTCCATATAAATTTCAGG - Intergenic
993598976 5:89896470-89896492 TGTGATTCCATATAAATTTTAGG - Intergenic
993644537 5:90446335-90446357 TGTGGTTCCATATGAATTTTGGG - Intergenic
993694596 5:91046168-91046190 TTTGATTCCATATGAATTTTAGG - Intronic
993840422 5:92871258-92871280 TGTGGTTCCATATGAATTTTAGG + Intergenic
993896051 5:93536437-93536459 TGTGATTCTGTATGAATTTCAGG - Intergenic
994016895 5:94977472-94977494 TGTGGTTCCATATGAATTTTAGG - Intronic
994036287 5:95204989-95205011 TGAATTTCCATATGAATTTTAGG - Intronic
994050939 5:95361498-95361520 TGTGGTTCCATATGAATTTTAGG + Intergenic
994283914 5:97940270-97940292 TGCAATTACATATGAATTTCAGG + Intergenic
994435044 5:99717641-99717663 TTAAATTTCCTATTAATTTCAGG + Intergenic
994627631 5:102241747-102241769 TGTCATTCCATATGAATTTTAGG - Intronic
994782307 5:104106005-104106027 TGAGATTCCACTTGAATTTTAGG + Intergenic
994870078 5:105336471-105336493 GGAGATTCCGTCTGAATTTTAGG + Intergenic
995102031 5:108323599-108323621 TTAGATTCCATATGAGTTTTAGG - Intronic
995489270 5:112673278-112673300 TGAAATTCCATATGAATTCTAGG + Intergenic
995626359 5:114081292-114081314 TGAGATTCCATATAAATTTTAGG - Intergenic
995696963 5:114889809-114889831 TGTGGTTCCATATAAATTTCAGG + Intergenic
996045446 5:118867926-118867948 TGAGATTTCATATGAATTTTAGG - Intronic
996047816 5:118895512-118895534 TGTGGTTCCATATGAATTGCAGG - Intronic
996326639 5:122282253-122282275 TTTGATTCCATATGAATTTTAGG + Intergenic
996355081 5:122586636-122586658 TGAGTTTTTCTATGTATTTCTGG + Intergenic
996364630 5:122688086-122688108 TGTGATTCCATATGAATTTTAGG - Intergenic
996426886 5:123322438-123322460 TAAAATTCCCTATGAATTTTAGG + Intergenic
997099307 5:130950877-130950899 TGTGGTTCCATATGAATTTTAGG + Intergenic
997143048 5:131403462-131403484 TGAGATTCCATATGCATTTTAGG - Intergenic
997174590 5:131761763-131761785 TGTGGTTCCGTATGAATTTAAGG - Intronic
997182190 5:131841581-131841603 TGTGGTTCCATATGAATTTTAGG + Intronic
997664055 5:135613931-135613953 TATGATTCCATATGAATTTTAGG + Intergenic
997719803 5:136069005-136069027 TGAGATTTTGTATGAATTTTAGG + Intergenic
997774368 5:136587106-136587128 TTTGATTCCATATGAATTTTAGG - Intergenic
997810872 5:136967481-136967503 TTAGATTCCATATGAATTTTGGG + Intergenic
998238030 5:140416827-140416849 TGAGATCCCATATTAATTTTAGG + Intronic
998703039 5:144726794-144726816 TTTGATTCCGTATGAATTTTAGG + Intergenic
999118676 5:149188866-149188888 TGAAATTCCATATGAATTTTAGG - Intronic
999313032 5:150564976-150564998 TGAAATTCCATATGAATATTAGG - Intergenic
999546466 5:152634306-152634328 GAAGATTCTCTATGAATTTAAGG + Intergenic
999553704 5:152718309-152718331 ACAAAATCCCTATGAATTTCTGG - Intergenic
999599506 5:153246089-153246111 TTTGGTTCCATATGAATTTCAGG + Intergenic
1000015894 5:157275641-157275663 TGAATTTCCATATGAATTTTAGG + Intronic
1000808941 5:165836776-165836798 TGTGGTTCCATATGAATTTTAGG - Intergenic
1001800368 5:174538262-174538284 TGAGATTCCATATGAATTTTGGG - Intergenic
1002152921 5:177250719-177250741 TGAGTTCCCCTATCAATTCCAGG + Intronic
1002326348 5:178410372-178410394 TGCTATTCCGTATGAATTTGAGG - Intronic
1002420430 5:179144419-179144441 TGACTTTCCATATGAATTTTAGG - Intronic
1002678931 5:180944973-180944995 TGTGATTCCATATGAATTTAAGG - Intronic
1002694648 5:181076981-181077003 TGTGGTTCCATATGAATTTTAGG - Intergenic
1002768219 6:262258-262280 TGCAATTGCCTATGAATTTGAGG + Intergenic
1003069206 6:2931434-2931456 TGAGAAACCCTATTAATTCCAGG + Intergenic
1003598068 6:7492807-7492829 TGCAATTCCATATGAATTTGAGG + Intergenic
1004148227 6:13089923-13089945 TGACATTCCCTATTCATTTCAGG - Intronic
1004228371 6:13809098-13809120 TGTATTTCCCTATGAATTTTAGG + Intronic
1004353806 6:14914066-14914088 TGAGATTCCATATAAATTTTAGG - Intergenic
1004652142 6:17620143-17620165 TGTGGTTCCATATGAATTTTAGG - Intronic
1004657616 6:17679516-17679538 TGAGATTCCATATGAATTTTAGG - Intronic
1004764162 6:18705970-18705992 TGGGATTCCATATAAATTTGTGG + Intergenic
1005000698 6:21237966-21237988 TGTGATTCCATATGAGTTTGAGG - Intergenic
1005100282 6:22165268-22165290 TGTGGTTCCATATGAATTTTAGG + Intergenic
1005156702 6:22814929-22814951 TGTGATTCCATATAAATTTTAGG + Intergenic
1005272581 6:24181817-24181839 TGAGATTCCATATGACTTATAGG - Intronic
1005313285 6:24580108-24580130 GGAGTCTCTCTATGAATTTCAGG + Intronic
1005462680 6:26084095-26084117 TGAATTTCCCTAGGAATTTTAGG - Intergenic
1005601929 6:27435138-27435160 TGAGATACCATGTGAATTTTAGG + Intergenic
1005611583 6:27530351-27530373 TGTGATTCCATATGAATTTTAGG + Intergenic
1006278424 6:33025642-33025664 TGTGGTTCCATATGAATTTAAGG + Intergenic
1006687452 6:35848204-35848226 TGTGATTCCATGTGAATTTTAGG - Intronic
1006745761 6:36340940-36340962 TGAGATTCACTGAGCATTTCCGG - Intergenic
1006828274 6:36952786-36952808 TGAGATTCCATATAAATTTTAGG + Intronic
1006895516 6:37466786-37466808 TGAGATTCCATATAAATTTTAGG + Intronic
1007457008 6:41986268-41986290 TGTGGTTTCATATGAATTTCAGG + Intronic
1007893294 6:45317347-45317369 TGTGGTTCCATATGAATTTTAGG - Intronic
1008009449 6:46449503-46449525 TGTGGTTCCATATAAATTTCAGG - Intronic
1008325100 6:50169418-50169440 TGTGATTCCATATAAATTTTAGG - Intergenic
1008550927 6:52629920-52629942 TGTATTTCCCTATGAATTTTAGG - Intergenic
1008940816 6:57043573-57043595 TTTGGTTCCCTATGAATTTTAGG - Intergenic
1008992347 6:57618226-57618248 TGCAATTCCATATGAATTTGAGG + Intronic
1009180971 6:60517338-60517360 TGCAATTCCATATGAATTTGAGG + Intergenic
1009277134 6:61697305-61697327 TCAAATTCCATATGAGTTTCTGG - Intronic
1009867462 6:69415082-69415104 TTAGGTTCCATATGAATTTTAGG - Intergenic
1010015186 6:71096963-71096985 TTTGATTCCGTATGAATTTTAGG + Intergenic
1010263548 6:73843390-73843412 TGTGATTCCATATAAATTTTAGG + Intergenic
1010265488 6:73861311-73861333 TGAGATTCCATATAAATTTTAGG + Intergenic
1010381251 6:75227604-75227626 TGTGGTTCCATATGAATTTTAGG - Intergenic
1010394151 6:75371476-75371498 TGAGATTCCATATGAATTTATGG - Intronic
1010563497 6:77380610-77380632 TGAGATTGCATATGCATTTTAGG - Intergenic
1010748965 6:79596777-79596799 TGAATTTCCATATGAATTTTAGG - Intergenic
1010775907 6:79885537-79885559 TGTGATTCCATATAAATTTTAGG - Intergenic
1010875269 6:81096422-81096444 TAAGATTCCATATGAATTTTGGG + Intergenic
1011446806 6:87450305-87450327 TGCGGTTCCATATGAATTTTAGG + Intronic
1011592128 6:88980171-88980193 TTTGATTCCATATGAATTTTAGG + Intergenic
1011630849 6:89322609-89322631 TTTGATTCCATATGAATTTGAGG - Intergenic
1011965470 6:93152050-93152072 TTTGGTTCCATATGAATTTCAGG + Intergenic
1012197725 6:96365178-96365200 TGTGATTCCATATGAATTTTAGG - Intergenic
1012780403 6:103549809-103549831 TGAGATTCTATATGATTTTAGGG - Intergenic
1012796049 6:103762926-103762948 TGTGATTCCATATAAATTTTAGG - Intergenic
1013223057 6:108096878-108096900 TGTGGTTCCATATGAATTTTAGG - Intronic
1013405895 6:109843222-109843244 TTTGATTCCATATGAATTTTAGG + Intergenic
1013526436 6:110978535-110978557 TGAATTTCCATATGAATTTTAGG - Intergenic
1013827229 6:114228811-114228833 GCAGATTCTCTATGAATTACAGG - Intronic
1014081622 6:117293055-117293077 TGAGGTATCCTATGTATTTCAGG - Intronic
1014118837 6:117699652-117699674 TGTGATTCCATATAAATTTTCGG - Intronic
1014793113 6:125697158-125697180 TGAATTTCCATATGAATTTTGGG - Intergenic
1014926685 6:127279580-127279602 TGCAATTCCATATGAATTTGAGG + Intronic
1014934394 6:127369578-127369600 TGTCATTCTATATGAATTTCAGG + Intergenic
1015032371 6:128610623-128610645 TGATATTCCATATGAATTTTAGG + Intergenic
1015193856 6:130503957-130503979 TGAGATTTCATATAAATTTTAGG - Intergenic
1015220611 6:130801319-130801341 TGAGATTCCATATGAATTATAGG + Intergenic
1015256853 6:131187107-131187129 TGAGGTTCAATATGAATTTTAGG + Intronic
1015257272 6:131192573-131192595 TGTGATTCCATGTGAATTTTAGG + Intronic
1015289040 6:131517322-131517344 TGTGGTTCCATATGAATTTTAGG + Intergenic
1015469157 6:133583824-133583846 TGAGATTCCAGAGGAATTTCAGG + Intergenic
1016137150 6:140557994-140558016 TCAGAATCCCATTGAATTTCAGG + Intergenic
1016368921 6:143350879-143350901 TGTGGTTCCATATGAATTTTAGG + Intergenic
1016421459 6:143888384-143888406 TGAGAGTCCATATGAATTTTAGG + Intronic
1016423084 6:143905056-143905078 TGAGATTCCATGTGAATTTTAGG + Intronic
1016504635 6:144765060-144765082 TGGGGTTCCCTATGAATTCTGGG + Intronic
1017273343 6:152535299-152535321 TTAGGTTCCCTATTAATTGCTGG - Intronic
1017401172 6:154064979-154065001 TAAGATTCCATATGAATTTCAGG + Intronic
1018150787 6:160935833-160935855 TGTGGTTCCATATGAATTTTAGG + Intergenic
1018622058 6:165739139-165739161 TGTGATTCCATATGAATTTTAGG - Intronic
1018636855 6:165869597-165869619 TGTGATTCCATATGAATTTAAGG - Intronic
1018770311 6:166964836-166964858 TTAGGTTCCATATGAATTTTAGG + Intergenic
1018917216 6:168141586-168141608 TGTGATTCCATATAAATTTTAGG + Intergenic
1018965420 6:168483603-168483625 TGACATTCCACATGAATTTTAGG - Intronic
1019044830 6:169137136-169137158 TGCGATTCCATGTGAATTTTAGG - Intergenic
1019087709 6:169496941-169496963 TGAGACTCCATTTGAATTTTAGG - Intronic
1019655050 7:2188339-2188361 TGAGATTCCATATGAATTTTAGG - Intronic
1019741079 7:2674207-2674229 TGTGGTTCCATATGAATTTTAGG + Intergenic
1019797441 7:3061944-3061966 TGAATTTCCATATGAATTTTAGG + Intergenic
1019945176 7:4322537-4322559 TGCAATTCCATATGAATTTTAGG + Intergenic
1020873215 7:13660551-13660573 TGGGATTCCATGTGAATTTTAGG - Intergenic
1021547893 7:21836251-21836273 TCTGATTCCATATAAATTTCAGG - Intronic
1021557603 7:21937288-21937310 TGAGATTCCACATTAATTTTAGG - Intronic
1021873255 7:25024830-25024852 TTTGATTCCATATGAATTTTAGG + Intergenic
1021956236 7:25827386-25827408 TGTGATTCCATATAAATTTTAGG - Intergenic
1021966031 7:25919743-25919765 TGAAATTCCATATAAATTTTAGG - Intergenic
1022387093 7:29911426-29911448 TGAGATTCCATATGAATTTTAGG - Intronic
1022721332 7:32943728-32943750 TTAGATTCCATATGAATTTTAGG - Intergenic
1023149370 7:37185968-37185990 TGAATTTCCACATGAATTTCAGG - Intronic
1023693623 7:42821955-42821977 TGAGGTTCCATATGAATTTTAGG - Intergenic
1023811087 7:43912561-43912583 TCAGATTCCATATGAACTTTAGG + Intronic
1024177724 7:46858600-46858622 TGTGATTCCATATGAATTTTAGG - Intergenic
1024187496 7:46967154-46967176 TGAAATTCCATGTGAATTTTAGG - Intergenic
1024296655 7:47848860-47848882 TGTGATTCCATATGAATTTTAGG - Intronic
1024480927 7:49861967-49861989 TGCAATTCCATATGAATTTTAGG + Intronic
1024490136 7:49972731-49972753 TGAGATTCCATGTGAATTTTAGG - Intronic
1024493032 7:50008521-50008543 TGAGATTTCATATGAATTTGAGG - Intronic
1024572567 7:50735903-50735925 TGAGAAGCCATATGAATTTTAGG - Intronic
1024926838 7:54625288-54625310 TGAGAGTCCATATGGATTTTAGG - Intergenic
1025149126 7:56533761-56533783 TGAGATTCCATATGAAATTTAGG - Intergenic
1026080752 7:67217736-67217758 TGAGAATCCATATGAATTTTAGG + Intronic
1026397939 7:69977427-69977449 TGAGATTACATATGAATTTTAGG + Intronic
1026696335 7:72596293-72596315 TGAGAATCCATATGAATTTTAGG - Intronic
1027191410 7:75998093-75998115 TGAGATTCCATATGAATTTTAGG - Intronic
1027488754 7:78795652-78795674 TGTGATTCCGTACGAATTTTAGG - Intronic
1027927151 7:84480493-84480515 TAAAATTCACTATGAATTTCTGG - Intronic
1028075690 7:86512056-86512078 TGTGGTTCCATATGAATTTTAGG + Intergenic
1028152065 7:87385183-87385205 TGTGGTTCCATATGAATTTTTGG + Intronic
1028161379 7:87489798-87489820 TGTGTTTCCATATGAATTTTAGG - Intergenic
1028176257 7:87662742-87662764 TGTGGTTCCATATGAATTTTAGG + Intronic
1028555566 7:92120261-92120283 TTAGTTTCCATATGAATTTTGGG - Intronic
1029005928 7:97209321-97209343 TGTGGTTCCATATGAATTTTAGG + Intergenic
1029070862 7:97896197-97896219 TGTGGTTCCATATGAATTTCAGG - Intergenic
1029106544 7:98181435-98181457 TCAGAATCCATATGAATTTTAGG - Intronic
1029404112 7:100363678-100363700 TCAGATTCCATTTGAATTTCAGG - Intronic
1029925827 7:104315788-104315810 TGAGATTCCATACAAATTTTAGG - Intergenic
1030089536 7:105845552-105845574 TGAATTTCCATATGAATTTTAGG - Intronic
1030250056 7:107433348-107433370 TGAGATTCCATATGAATTTTAGG - Intronic
1030443456 7:109618955-109618977 TGTGATTCCATATGAATTTTAGG + Intergenic
1030661053 7:112220045-112220067 TGTGGTTCCATATGAATTTTAGG + Intronic
1030673218 7:112359976-112359998 TGAGAGTCCATATGAATTTTAGG - Intergenic
1030691095 7:112534602-112534624 TGCAATTCCTTATGAATTTTAGG + Intergenic
1031286177 7:119870664-119870686 TGTGATCCCATATGAATTTTAGG + Intergenic
1031471280 7:122172162-122172184 AGAGTTTCCCTATCAATTACTGG - Intergenic
1031506411 7:122590106-122590128 AGAGATTCCTTATGAATTTTAGG - Intronic
1031542988 7:123017822-123017844 TGAGATTTCATATAAATTTTAGG + Intergenic
1031906129 7:127461824-127461846 TGTTATTCCATATGAATTTTGGG - Intergenic
1031933940 7:127716198-127716220 TGAGATTCCATATGAATTTTAGG + Intronic
1032099724 7:128964285-128964307 TGAAATTCCATATGAATTTTAGG - Intronic
1032596875 7:133250287-133250309 TTAATTTCCGTATGAATTTCAGG + Intergenic
1032605810 7:133350677-133350699 TGAGATTCTGTATGAATTTCAGG + Intronic
1032661785 7:133991944-133991966 TGTGATTCCATTTGAATTTTAGG + Intronic
1033381515 7:140824609-140824631 TGAGATACGGTATGAATTTTAGG + Intronic
1033462437 7:141559600-141559622 TGAGATTCCATATGAATTTTGGG + Intronic
1033669240 7:143474961-143474983 TGTGATTCCACATGAATTTTAGG - Intergenic
1033766309 7:144494792-144494814 TGTGGTTCCATATGAATTTTAGG + Intronic
1034008499 7:147502224-147502246 TGTGATTCCACATGAATTTTAGG - Intronic
1034545899 7:151789140-151789162 TAAGATTCCACATGAATTTTAGG + Intronic
1035091100 7:156311492-156311514 TGTGGTTCCATATGAATTTTAGG + Intergenic
1035172543 7:157026196-157026218 TGTGGTTCCATATGAATTTTGGG + Intergenic
1035309761 7:157958900-157958922 TGAGATTCCATATAAATTTTTGG - Intronic
1035365530 7:158347593-158347615 TGTGGTTCCATATGAATTTTAGG + Intronic
1035545175 8:475429-475451 TGAGATTCCATATGAGTTTCAGG + Intergenic
1035564670 8:633539-633561 TGAGATTCCATGTGAATTTAGGG - Intronic
1035630362 8:1102998-1103020 TGTGGTTCCCTATGAGTCTCTGG + Intergenic
1035630366 8:1103027-1103049 TGTGGTTCCCTATGAGTCTCTGG + Intergenic
1035840439 8:2806163-2806185 TGTGAGTCCATATGAATTTAAGG + Intergenic
1036247710 8:7133581-7133603 TGTGGTTCCATATGAATTTCAGG + Intergenic
1036253105 8:7180803-7180825 TGTGGTTCCATATGAATTTCAGG - Intergenic
1036364391 8:8106671-8106693 TGTGGTTCCATATGAATTTCAGG + Intergenic
1036394343 8:8355414-8355436 TGTCATTCCATATGAATTTTAGG - Intronic
1036886550 8:12559455-12559477 TGTGGTTCCATATGAATTTCAGG - Intergenic
1036894159 8:12618528-12618550 TGTGGTTCCATATGAATTTCAGG - Intergenic
1036989223 8:13572962-13572984 TGGGATTCCATATGAATTTTAGG + Intergenic
1037055159 8:14431190-14431212 TTTGATTCCATATGAATTTTAGG - Intronic
1037124003 8:15323129-15323151 TGAGATTCCATATGAATTTTAGG - Intergenic
1037169377 8:15873655-15873677 TGAATTTCCATATGAATTTTAGG - Intergenic
1037284481 8:17283816-17283838 TGAGATTCCGTATGAATTTTAGG + Intronic
1037461916 8:19119474-19119496 TGAGAATCCCTAAGAGATTCTGG - Intergenic
1037956131 8:23060630-23060652 AGAAATTCCATATGAATTTTAGG + Intronic
1037975884 8:23211545-23211567 TGAAATTCCATATTAATTTTAGG - Intronic
1037978919 8:23236447-23236469 TGAGATTCCATATACATTTTAGG - Intergenic
1038237959 8:25779555-25779577 TGTGGTTCCGTATGAATTTTAGG + Intergenic
1038378475 8:27068412-27068434 TGTGGTTCCATATGAATTTCAGG - Intergenic
1038555978 8:28516385-28516407 TGTAATTCCATATGAATTTTAGG + Intronic
1038877957 8:31572802-31572824 TAAGATTCCATATAAATTTTAGG - Intergenic
1039313605 8:36347215-36347237 TGAAATTCCATATGAATTTTAGG - Intergenic
1039463975 8:37770141-37770163 TGTGGTTCCATATAAATTTCAGG - Intronic
1039640480 8:39215167-39215189 TGTGATTCCATATAAATTTTAGG + Intronic
1040656058 8:49509414-49509436 TGAGATTCCATGTGAATTTTAGG - Intergenic
1040670745 8:49687195-49687217 TTTGATTCCTTATGAATTTTAGG + Intergenic
1040693263 8:49965336-49965358 TGAGTTTCTTTATGAACTTCTGG + Intronic
1040867371 8:52062436-52062458 TGAGTTTCCATACGAATTTGAGG + Intergenic
1040922414 8:52637064-52637086 TGCAATTCCATATGAATTTTAGG + Intronic
1040967387 8:53097808-53097830 TGAGATTCCATATGAATTTTAGG - Intergenic
1041206436 8:55503180-55503202 TGTGATTCCATACGAATTTTAGG + Intronic
1041268847 8:56091041-56091063 TAATATTCCATATGAATTTTAGG + Intergenic
1041403986 8:57476256-57476278 TTACATTCCATATGAATTTGAGG + Intergenic
1041819023 8:62008297-62008319 TATGATTACCTATGAATTTAAGG + Intergenic
1041940237 8:63379420-63379442 TGAAACTCCTTATGAATTTTAGG + Intergenic
1042286668 8:67120353-67120375 GGAGATTCCATATGAATTATGGG + Intronic
1043059929 8:75487651-75487673 TGAATTTTCCTCTGAATTTCAGG + Intronic
1043258548 8:78167436-78167458 TGAGATTAAATATGAATTTTAGG - Intergenic
1043913422 8:85891865-85891887 TGTGATTCCATATGAATTTTAGG - Intergenic
1044037899 8:87328594-87328616 TGTGATTCCATATCAATTTTAGG + Intronic
1044476968 8:92638392-92638414 TGAGATTCCAAATGAATTGAGGG + Intergenic
1044874833 8:96655104-96655126 TTTAATTCCCTATGAATTTTAGG + Intronic
1044920099 8:97160632-97160654 TGAGATTTCATGTGAATTTCAGG + Intergenic
1044943883 8:97372321-97372343 TGAGACTCCATATGAATATTAGG - Intergenic
1045072572 8:98524341-98524363 TGAGAATCCATATGAATTTTAGG + Intronic
1045132295 8:99166715-99166737 TGAGAGTCCATATGAATTTTAGG - Intronic
1045518521 8:102882326-102882348 TGAGATTTCATATAAATTTTAGG - Intronic
1046119146 8:109822934-109822956 TGAGTTTCCATATAAATTTTGGG + Intergenic
1046147521 8:110180627-110180649 TGTGATTCCATATAAATTTTAGG + Intergenic
1046163134 8:110393634-110393656 TTAGGTTCCATATGAATTTTGGG - Intergenic
1046975731 8:120274993-120275015 TTGGGTTCCATATGAATTTCAGG - Intronic
1047165064 8:122429356-122429378 TATGGTTCCATATGAATTTCAGG - Intergenic
1047217696 8:122890449-122890471 TGTGATTCCATATGAATTTTAGG + Intronic
1047318188 8:123753994-123754016 TGTGGTTCCTTATGAATTTCAGG - Intergenic
1047722929 8:127658892-127658914 TTAGATGCCATATGAATTTTAGG - Intergenic
1047902140 8:129434752-129434774 TGTGATTCCATATAAATTTGAGG - Intergenic
1047917513 8:129598416-129598438 TGAAATTCCATATGAATTTCTGG + Intergenic
1047972922 8:130101270-130101292 TGTGTTTCCATATGAATTTTAGG + Intronic
1048108180 8:131435659-131435681 CGTGGTTCCATATGAATTTCAGG - Intergenic
1048160831 8:132019631-132019653 TGTGGTTCCATATGAATTTTAGG - Intergenic
1048382267 8:133876503-133876525 TGAGATTCCATATTAATTTTAGG + Intergenic
1048805109 8:138233078-138233100 TGTAATTCCATATGAATTTTAGG - Intronic
1048996581 8:139797988-139798010 TGAATTTCCATATGAATTTTAGG + Intronic
1049026080 8:139989852-139989874 TGAGATACCGTATGAGTTTTCGG - Intronic
1049067704 8:140330969-140330991 TAAGGTTCCATATGAATTTTAGG - Intronic
1049078472 8:140420369-140420391 TGAATTTCCGTATGAATTTTAGG - Intronic
1049840810 8:144770361-144770383 TGCCATTCCATATGAAGTTCAGG - Intergenic
1050076194 9:1867581-1867603 TGTGGTTCAATATGAATTTCAGG - Intergenic
1050389523 9:5124559-5124581 TTTGGTTCCCTATGAATTTTAGG - Intronic
1050398054 9:5220929-5220951 TGAGATTCCATATGAATATTAGG - Intergenic
1050439560 9:5647299-5647321 TGGGAATCCATATGAATTTTAGG + Intronic
1050488157 9:6157672-6157694 TGAAATTTCATATGAATTTTAGG - Intergenic
1050578242 9:7022144-7022166 TGTGATTCCATATAAATTTTAGG + Intronic
1050974328 9:11917247-11917269 TGAGATTGTATATGAATTTTAGG + Intergenic
1051012298 9:12432093-12432115 TTGGATTCCATATGAATTTTGGG + Intergenic
1051133421 9:13889724-13889746 TGAGATTCCATATGAATTTTAGG - Intergenic
1051280334 9:15436632-15436654 TGAAATTCCCTATGAATTTTAGG + Intronic
1051455659 9:17254777-17254799 TAAGATTTCATATGAATTTTAGG + Intronic
1051500679 9:17773787-17773809 TGAGATTCCATATGAATTTTAGG + Intronic
1052064329 9:23998160-23998182 TGTGATTCTCTATAAATTTTAGG - Intergenic
1052435384 9:28421436-28421458 TGAAATTCCAAATGAATTTTAGG - Intronic
1052450470 9:28623685-28623707 TGTGCTTCCATATAAATTTCAGG + Intronic
1052452022 9:28643189-28643211 TGTGATTCCATATAAATTTCAGG - Intronic
1052733209 9:32313661-32313683 TGTGGTTCCATATAAATTTCAGG - Intergenic
1053115296 9:35495659-35495681 TAAGATTCCATATGAATTTTAGG + Intronic
1053170503 9:35877134-35877156 TGAGATTCCATATGAATCTTAGG + Intergenic
1053522896 9:38799240-38799262 TTTGGTTCCATATGAATTTCAGG + Intergenic
1053556640 9:39144985-39145007 TGAGGTTCCCTATGAATTTTAGG - Intronic
1053722932 9:40966312-40966334 TGTGATTCTATATGAATTTTAGG + Intergenic
1053820750 9:41965268-41965290 TGAGGTTCCCTGTGAATTTTAGG - Intronic
1054089618 9:60833407-60833429 TGAGGTTCCCTATGAATTTTAGG - Intergenic
1054111029 9:61108965-61108987 TGAGGTTCCCTATGAATTTTAGG - Intergenic
1054195121 9:62023657-62023679 TTTGGTTCCATATGAATTTCAGG + Intergenic
1054275118 9:63060393-63060415 TGTGGTTCCATATGAGTTTCAGG + Intergenic
1054343036 9:63885687-63885709 TGTGATTCTATATGAATTTTAGG - Intergenic
1054399711 9:64704537-64704559 TGTGGTTCCATATGAGTTTCAGG - Intergenic
1054433297 9:65188797-65188819 TGTGGTTCCATATGAGTTTCAGG - Intergenic
1054497088 9:65832872-65832894 TGTGGTTCCATATGAGTTTCAGG + Intergenic
1054609828 9:67222160-67222182 TGAGGTTCCCTATGAATTTTAGG + Intergenic
1054643287 9:67565033-67565055 TTTGGTTCCATATGAATTTCAGG - Intergenic
1054833862 9:69655719-69655741 TGTGGTTCCATATGAATTTTAGG - Intronic
1054868828 9:70030131-70030153 TGTGGTTCCATATGAATTTTTGG + Intergenic
1055153438 9:73031617-73031639 TGTGATTTCACATGAATTTCAGG + Intronic
1055847087 9:80578862-80578884 TGATTTTCCATATGAATTTTTGG - Intergenic
1056155257 9:83828477-83828499 TAAGTTTCCATATGAATTTTAGG - Intronic
1056306938 9:85299806-85299828 TTAGATTCCCTATTAAAATCTGG - Intergenic
1056355228 9:85794636-85794658 TAAGTTTCCATATGAATTTTAGG + Intergenic
1056431948 9:86536496-86536518 TGAGATTCCATATTAACTTTAGG - Intergenic
1056890741 9:90489318-90489340 TGAGTCACCCTTTGAATTTCCGG + Intergenic
1057065980 9:92052096-92052118 TGAAATTCCATTTGAATTTTAGG - Intronic
1057362392 9:94385832-94385854 TGCAATTCCATATGAATTTGAGG + Intronic
1057484862 9:95475132-95475154 TTAGGATTCCTATGAATTTCAGG + Intronic
1057579737 9:96276404-96276426 TGTGGTTCCATATGAATTTTTGG - Intronic
1057616081 9:96591571-96591593 TGAGGTTCCATATAAATTTTAGG + Intronic
1057660949 9:97002266-97002288 TGCAATTCCATATGAATTTGAGG - Intronic
1058269838 9:102957792-102957814 TGAGATTCCATATGCATTTTAGG + Intergenic
1058304227 9:103416979-103417001 TGGAATTCCATATGAATTTTGGG + Intergenic
1058652171 9:107186475-107186497 TGTGGTTCCATATGAATTTTAGG - Intergenic
1059033043 9:110721742-110721764 TTAGGTTCCATATGAATTTTAGG - Intronic
1059264628 9:113015058-113015080 TGTGGTTCCAAATGAATTTCAGG + Intergenic
1059320895 9:113468540-113468562 TGAATTTCCATATGAATTTTAGG + Intronic
1059397385 9:114045703-114045725 TGCATTTCCATATGAATTTCAGG + Intronic
1060020086 9:120122150-120122172 AGTGATTCCATATGAATTTTAGG + Intergenic
1060082692 9:120666075-120666097 TGTGATTCCATATGAATTTTAGG + Intronic
1060112274 9:120914709-120914731 CAAGATTCCCCATGAACTTCAGG - Intronic
1060257148 9:122041922-122041944 TGTAATTCCATATGAATTTTAGG - Intronic
1060571879 9:124649095-124649117 TGAGGTTTCATATGAATTTTAGG - Intronic
1061815823 9:133195097-133195119 TGAGATTCCATGTGAATTTTGGG - Intergenic
1062663653 9:137654602-137654624 TAAGTTTCCATATGAATTTTAGG + Intronic
1062667911 9:137687305-137687327 TGAATTTCCTTATGAATTTTAGG + Intronic
1203750810 Un_GL000218v1:78148-78170 GGAGATTCCATATGAATTTTAGG - Intergenic
1203452226 Un_GL000219v1:129672-129694 TGTGATTCTATATGAATTTTAGG - Intergenic
1203709505 Un_KI270742v1:84253-84275 GGAGATTCCATATGAGTTTTAGG - Intergenic
1203541572 Un_KI270743v1:93311-93333 ATAGATTCCATATGAATTTTAGG + Intergenic
1186117007 X:6314801-6314823 TGCAATTCCATGTGAATTTCAGG + Intergenic
1186195118 X:7103073-7103095 TGAGATTTTTTATGAATTTTAGG - Intronic
1186588885 X:10907036-10907058 TGTGGTTCCATAGGAATTTCAGG + Intergenic
1186972801 X:14867233-14867255 TGTGGTCCCATATGAATTTCAGG - Intronic
1187088759 X:16070903-16070925 TGTGGTTCCATATAAATTTCAGG + Intergenic
1187108861 X:16274746-16274768 TTTGGTTCCATATGAATTTCAGG + Intergenic
1187379861 X:18791228-18791250 TGAATTTCCATATGAATTTTAGG + Intronic
1187440703 X:19316371-19316393 TGTGGTTCCATATGAATTTTAGG + Intergenic
1187770980 X:22695526-22695548 TGTGGTTCCATATGAATTTTAGG - Intergenic
1187821588 X:23293484-23293506 GCAAATTCCCTATGAATTCCAGG + Intergenic
1187844045 X:23518005-23518027 TGTGATTCCATATAAATTTTAGG + Intergenic
1187926399 X:24254460-24254482 TTACATTCCATATGAATTTGAGG - Intergenic
1187943573 X:24405105-24405127 TGAGCTTCCATATGAATTTTAGG + Intergenic
1188079663 X:25821595-25821617 TGTGGTTCCATATGAATTGCAGG - Intergenic
1188080408 X:25832158-25832180 TATGGTTCCCTATGAATTTTAGG + Intergenic
1188733490 X:33682536-33682558 TGTCATTCCATATAAATTTCAGG + Intergenic
1188831567 X:34904538-34904560 TGTGGTTCCATATGAATTTTAGG - Intergenic
1188855790 X:35194070-35194092 TGAGTTTCCATATGAATTTGAGG + Intergenic
1188912899 X:35871806-35871828 TGAGATTCCATATGTATGTTAGG + Intergenic
1188963481 X:36522328-36522350 TGAGATAGCATATGAATTTTAGG + Intergenic
1189136021 X:38551127-38551149 TGTGATTCCATATAAATTTTAGG + Intronic
1189412617 X:40786950-40786972 TGTGGTTCCATATGAATTTTAGG - Intergenic
1189718444 X:43889215-43889237 TGTGTTTCCATATGAATTTTAGG + Intergenic
1190068078 X:47256515-47256537 TGTGATTCCATATAAATTTTAGG + Intergenic
1190490553 X:50978707-50978729 TGAGTTTCCATAGGAATTTTAGG - Intergenic
1190724999 X:53183525-53183547 TGTAATTCCATATGAATTTGAGG + Intergenic
1191029825 X:55957380-55957402 TGAGATTCCACATGAATTTTAGG + Intergenic
1191082759 X:56531062-56531084 TGAGATCACTTATGAATTTCTGG - Intergenic
1191624231 X:63252017-63252039 TGACATTCCTTATAAATTTTAGG - Intergenic
1191709055 X:64129082-64129104 TGAGATTCCATATGAATTTTAGG - Intergenic
1191725817 X:64279635-64279657 TGCAATTCCATATGAATTTTAGG - Intronic
1191815776 X:65242630-65242652 TGTGATTCCATATAAATTTCAGG - Intergenic
1191830787 X:65413777-65413799 TGTGATTCCATATGAACTTGAGG + Intronic
1192063195 X:67852610-67852632 TGAGATTTCATAGGAATTTTAGG - Intergenic
1192242514 X:69344846-69344868 TGAGATTCCATATGAATTTGAGG + Intergenic
1192257412 X:69474069-69474091 TGAGATTCCATATGAAGTTTAGG - Intergenic
1192397627 X:70798489-70798511 TGTGATTCCATATAAATTTGAGG - Intronic
1192586514 X:72322908-72322930 GGAAACTCCATATGAATTTCAGG + Intergenic
1192671700 X:73151028-73151050 TGTGGTTCCATATGAATTTTAGG + Intergenic
1192712740 X:73608391-73608413 TGAGTTTTCCTGTGAATTTTAGG + Intronic
1192774607 X:74229576-74229598 TGAATTTCCATATGAATTTTAGG - Intergenic
1192885283 X:75330293-75330315 TGTGGTTCCCTATGAATTTTAGG + Intergenic
1192919213 X:75688015-75688037 TGAGATTTTATATGAATTTTAGG + Intergenic
1193088213 X:77466601-77466623 TGTGGTTCCATATGAATTTAAGG + Intergenic
1193134783 X:77958586-77958608 TGTCATTCCATATGAATTTTAGG + Intronic
1193163012 X:78249588-78249610 TTTGGTTCCATATGAATTTCAGG + Intergenic
1193248170 X:79255171-79255193 TGTGATTCCATATAAATTTTGGG - Intergenic
1193302797 X:79911872-79911894 TTTGGTTCCATATGAATTTCAGG + Intergenic
1193327274 X:80193327-80193349 TGAGATTTCATATAAATTTTAGG + Intergenic
1193632193 X:83903687-83903709 TGAGATTCCATATAAATTTTAGG - Intergenic
1193767814 X:85552565-85552587 TGAGATTCCATACGAATTTTAGG + Intergenic
1193934846 X:87605253-87605275 TGTGGTTCCATATGAATTTTAGG + Intronic
1194136982 X:90157293-90157315 TGTGATTCCATATTAATTTTAGG - Intergenic
1194236284 X:91388048-91388070 TGTGGTTCCATATGAATTTTAGG - Intergenic
1194362502 X:92970382-92970404 TGAAATTCCACATGAATTTTGGG + Intergenic
1194609401 X:96022583-96022605 TGAGATTCCATATGAATTTTAGG - Intergenic
1194689096 X:96960096-96960118 TGTGGTTCCATATGAATTTTAGG + Intronic
1194789140 X:98124670-98124692 TGCATTTCCCTATGAATTTTTGG + Intergenic
1195019626 X:100813712-100813734 TGAATTTCCATATGAATTTTAGG - Intergenic
1195056827 X:101154233-101154255 TGAAATTCCATATGAATTTTAGG + Intronic
1195253617 X:103072548-103072570 TGAGTTTCCATATGAATTTTAGG - Intergenic
1195297603 X:103494907-103494929 TGTGATTCTATATGAATTTTAGG + Intergenic
1195304589 X:103568023-103568045 TGAGATTCCATATGAATTTTAGG - Intergenic
1195371500 X:104179130-104179152 TGCAATTCCATATGAATTTTAGG + Intronic
1195456078 X:105071520-105071542 TGTGATTTCATATGAATTTTAGG - Intronic
1195493216 X:105498542-105498564 TGTGTTTCCATATGAATTTTAGG - Intronic
1195745147 X:108109957-108109979 TGAGATTTCATATGAGTTTTAGG + Intronic
1195806050 X:108767052-108767074 TGAATTTCCATATGAATTTTAGG + Intergenic
1195815994 X:108888706-108888728 TGAGTTTCCATTTGAATTTTAGG - Intergenic
1195873397 X:109511785-109511807 TGAGATTCCATATGAATTTTAGG - Intergenic
1196023767 X:111018743-111018765 TGAGATTCCATATAAATTTTAGG - Intronic
1196142724 X:112282482-112282504 TGTGGTTCCATATGAATTTTAGG + Intergenic
1196216106 X:113053592-113053614 TGTGGTTCCATATAAATTTCAGG - Intergenic
1196262618 X:113602099-113602121 TGAGATTACATATTAATTTTGGG - Intergenic
1196323639 X:114374331-114374353 TGAGTTTCCATATCAATTTTAGG - Intergenic
1196465209 X:115965300-115965322 TTTGATTCCATATGAATTTTAGG - Intergenic
1196493946 X:116301838-116301860 TGTGGTTCCATATAAATTTCCGG + Intergenic
1196578751 X:117354095-117354117 TGTGATTCCATATAAATTTTAGG + Intergenic
1196619981 X:117810435-117810457 TGTGGTTCCATATGAATTTTAGG - Intergenic
1196708101 X:118734102-118734124 TGAGATTTCATAAGAATTTTAGG + Intronic
1197038954 X:121910990-121911012 TGAAATTCCATATGAATGTGAGG + Intergenic
1197062710 X:122200282-122200304 TGTGGTTCCATATGAATTTTAGG - Intergenic
1197103723 X:122688178-122688200 TTTGATTCCATATGAATTTTAGG - Intergenic
1197113125 X:122799930-122799952 TGTGATTCCATATAAATATCAGG - Intergenic
1197121537 X:122898771-122898793 TGCAATTCCATATGAATTTTGGG + Intergenic
1197402918 X:126014324-126014346 TGTGATTCCATATAAATTTTAGG + Intergenic
1197552615 X:127912025-127912047 TGTGGTTCCATATGAATTTTAGG - Intergenic
1197574147 X:128188345-128188367 TGAAATTCCATATGAATATTAGG + Intergenic
1197611724 X:128646577-128646599 TTTGGTTCCATATGAATTTCAGG + Intergenic
1197682232 X:129398182-129398204 TGTGAGTCCATATGAATTTTGGG - Intergenic
1197915763 X:131533020-131533042 TGAAATTCCATATGTATTTTAGG - Intergenic
1198297268 X:135300103-135300125 TGAATTTCCATATGAATTTTAGG + Intronic
1198514804 X:137395302-137395324 TGTGGTTCCCTATAAATTTTAGG + Intergenic
1198608104 X:138366858-138366880 TGAATTTCCATATGAATTTTAGG + Intergenic
1198796202 X:140398099-140398121 TGAGATTTTCTATGAATTTCTGG + Intergenic
1198796767 X:140405300-140405322 TTTGATTCCATATGAATTTTAGG + Intergenic
1199121967 X:144065444-144065466 TTTGATTCCATATGAATTTTAGG - Intergenic
1199459098 X:148063106-148063128 TGTGATTCCATATAAATTTTAGG + Intergenic
1199749040 X:150797578-150797600 TGAAATTCCATGTGAATTTTAGG - Intronic
1199888864 X:152054277-152054299 TGTAATTCCATATGAATTTCAGG - Intergenic
1200288919 X:154852692-154852714 TGAAATTCCATCTGAATTTTAGG + Intronic
1200311259 X:155080273-155080295 AGAAATTCCCTACGAATTTAAGG + Intronic
1200355243 X:155542514-155542536 TGAGATTCCGTATGACTTTTAGG - Intronic
1200482721 Y:3727235-3727257 TGTGATTCCATATTAATTTTAGG - Intergenic
1200670752 Y:6086602-6086624 TGAAATTCCACATGAATTTTGGG + Intergenic
1201164465 Y:11195778-11195800 GGCGATTCCATATGAATTTTAGG - Intergenic
1201789289 Y:17820696-17820718 TGAGATTTGCTTTAAATTTCAGG + Intergenic
1201812264 Y:18085291-18085313 TGAGATTTGCTTTAAATTTCAGG - Intergenic
1202018894 Y:20443788-20443810 TGAGTTTCCCTAAGATTTTCAGG - Intergenic