ID: 985487261

View in Genome Browser
Species Human (GRCh38)
Location 5:158560-158582
Sequence GAGACTCCCAGGACGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 2, 1: 0, 2: 8, 3: 25, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985487261_985487272 15 Left 985487261 5:158560-158582 CCTCTGCCCGTCCTGGGAGTCTC 0: 2
1: 0
2: 8
3: 25
4: 238
Right 985487272 5:158598-158620 CTCGTTCTACTCCGTCCTTGGGG No data
985487261_985487269 13 Left 985487261 5:158560-158582 CCTCTGCCCGTCCTGGGAGTCTC 0: 2
1: 0
2: 8
3: 25
4: 238
Right 985487269 5:158596-158618 TCCTCGTTCTACTCCGTCCTTGG 0: 1
1: 1
2: 0
3: 6
4: 63
985487261_985487275 18 Left 985487261 5:158560-158582 CCTCTGCCCGTCCTGGGAGTCTC 0: 2
1: 0
2: 8
3: 25
4: 238
Right 985487275 5:158601-158623 GTTCTACTCCGTCCTTGGGGGGG No data
985487261_985487274 17 Left 985487261 5:158560-158582 CCTCTGCCCGTCCTGGGAGTCTC 0: 2
1: 0
2: 8
3: 25
4: 238
Right 985487274 5:158600-158622 CGTTCTACTCCGTCCTTGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
985487261_985487273 16 Left 985487261 5:158560-158582 CCTCTGCCCGTCCTGGGAGTCTC 0: 2
1: 0
2: 8
3: 25
4: 238
Right 985487273 5:158599-158621 TCGTTCTACTCCGTCCTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 32
985487261_985487271 14 Left 985487261 5:158560-158582 CCTCTGCCCGTCCTGGGAGTCTC 0: 2
1: 0
2: 8
3: 25
4: 238
Right 985487271 5:158597-158619 CCTCGTTCTACTCCGTCCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985487261 Original CRISPR GAGACTCCCAGGACGGGCAG AGG (reversed) Intronic
900103215 1:971577-971599 GAGAACCTCAGGGCGGGCAGGGG - Intronic
900194762 1:1370660-1370682 GAGCCTCCCGGGAAGGGCACTGG - Intergenic
900433079 1:2612041-2612063 GGGACTCCGTGGAGGGGCAGGGG - Intronic
900484549 1:2915245-2915267 AAGAGTCCAAGGAGGGGCAGTGG + Intergenic
900888230 1:5430387-5430409 GAGACACCCAGGAGGGTGAGAGG - Intergenic
902415054 1:16233572-16233594 GGGCCTCCCAGGATGGGCAAAGG + Intronic
904921189 1:34009563-34009585 GAGAGACCCAGGGCAGGCAGAGG - Intronic
905943702 1:41884537-41884559 GAGGCTGGCAGGATGGGCAGTGG - Intronic
906117467 1:43366243-43366265 GAGAGTCCCAGGAAAGGCAGAGG - Intronic
907046520 1:51303215-51303237 GAGGCTCCCAGAGAGGGCAGGGG + Intronic
907425511 1:54376824-54376846 GAAACTCCTGGGATGGGCAGTGG - Intronic
907463775 1:54621898-54621920 GTGACTCCCAAGAAGGGCACAGG + Intronic
910445946 1:87299155-87299177 GAGACTCCTAGGCAGGGCATAGG + Intergenic
911319601 1:96396469-96396491 GAGAGTCCCAGGAGAGGCTGTGG + Intergenic
915214375 1:154330077-154330099 GGGAATCCCAGGACTGTCAGTGG + Intronic
915294696 1:154911798-154911820 GAGTGTGCCAGGAAGGGCAGGGG - Intergenic
917944457 1:179954851-179954873 GTGACTCCCGGGCCGGGGAGCGG + Exonic
918109881 1:181446168-181446190 GGGACTTCCAGGACTGGGAGAGG + Intronic
919925679 1:202190779-202190801 GAGCCTCCTAGGAAGGCCAGAGG - Intergenic
920694747 1:208173902-208173924 GGCATTCCCAGGAGGGGCAGAGG - Intronic
922505321 1:226122496-226122518 GGGTCTCCCAGGCCGGGCCGGGG - Intergenic
923031122 1:230249689-230249711 AAGATTCCCAGGCCGGGCGGTGG + Intronic
1064342188 10:14497542-14497564 GAGGCTTCCAGCACTGGCAGTGG + Intergenic
1065588644 10:27243271-27243293 GAGCCTCCCAGCACATGCAGTGG - Intergenic
1067407462 10:46036166-46036188 GAGGCTCCCAGGTAGGGCATGGG - Intronic
1067683378 10:48453815-48453837 GAGGCACCCAGGAGGGACAGAGG + Intronic
1070537292 10:77389316-77389338 GAGGCCCCCAGGAGGGGCTGAGG - Intronic
1070799768 10:79238369-79238391 GATACGCCCAGGAAGGGGAGCGG + Intronic
1070809461 10:79290358-79290380 GAGACTCCCTGACTGGGCAGAGG - Intronic
1072430794 10:95369098-95369120 TGGACTCCCAGGAAGGTCAGTGG - Intronic
1072626219 10:97113942-97113964 TACACTCCCAGGTGGGGCAGGGG + Intronic
1073325537 10:102642584-102642606 CGGACTCCCAGGCCGGGCCGTGG + Intergenic
1075418432 10:122282815-122282837 GAAAATCCCAGGACGGGCAGGGG + Intronic
1076585701 10:131546219-131546241 AAGACACCGAGGAGGGGCAGAGG - Intergenic
1076889865 10:133278110-133278132 GAGGCTCCCAGGTAGGGCTGGGG + Intergenic
1077374139 11:2197666-2197688 GACACTGCCAGGCAGGGCAGGGG + Intergenic
1077481356 11:2816128-2816150 GAGTTTCCCAGGATGGGCAGAGG - Intronic
1078856461 11:15209418-15209440 GGGACACCCAGCACAGGCAGAGG - Intronic
1079089912 11:17473592-17473614 GAGACTGCCAGGAGAGGGAGTGG - Intronic
1079486079 11:20937197-20937219 AAGGCTGCCAGGAAGGGCAGCGG - Intronic
1080686762 11:34522438-34522460 TAGATTGCCAGGAAGGGCAGAGG + Intergenic
1081914136 11:46720020-46720042 GAGACCCCCAGGAAAGGCTGAGG - Intronic
1083299329 11:61732117-61732139 GAGACACCCAGGACAGGGAGGGG - Intronic
1083806534 11:65077746-65077768 GGGACTCCCAGACCTGGCAGAGG + Exonic
1084087245 11:66860256-66860278 GGGACTCCCAGGCCAGGCGGCGG - Exonic
1084435441 11:69136695-69136717 GAGAAACCCAGGACCAGCAGAGG + Intergenic
1085401525 11:76238728-76238750 GAGACTCCCAGGAAGGGCCCCGG - Intergenic
1089065056 11:115656432-115656454 GAGACTCCCAGGAGGGGGACTGG - Intergenic
1090806150 11:130203563-130203585 GAGACTGCACGGACGGGCAGGGG - Intronic
1091386793 12:101097-101119 GAGAAGCCCAGGCCTGGCAGGGG + Intronic
1091600725 12:1916187-1916209 AAGACTATCAGGAAGGGCAGGGG + Intronic
1093512876 12:19949602-19949624 GAGACTGGCAGGCAGGGCAGTGG - Intergenic
1093561979 12:20552541-20552563 GCGTCCCCCAGGACGGGCAAGGG + Intronic
1100329253 12:93570061-93570083 GAGAATCCCAGGTAGGGTAGAGG + Intronic
1101221794 12:102649235-102649257 GAGATTCCTAGGACTGGAAGTGG + Intergenic
1101880954 12:108625270-108625292 GAGACTCTGAGGACTGGCAAGGG - Intronic
1101999762 12:109549998-109550020 GAGAGTCCCTGGCCGGGCCGGGG + Intergenic
1102327381 12:111998808-111998830 GAGACTCTCAGGAAAGGCAAAGG + Intronic
1102881864 12:116491571-116491593 GAGACCCGCTGGATGGGCAGCGG + Intergenic
1103583510 12:121934092-121934114 GAAACACCCAGGAAGGCCAGCGG + Intronic
1106683477 13:32031757-32031779 GAGGCTGGGAGGACGGGCAGCGG - Exonic
1108684211 13:52804737-52804759 GGGAGGCCCAGGACTGGCAGAGG - Intergenic
1108688728 13:52844650-52844672 GAGCCTCCCTGGACGGGGAGGGG + Exonic
1112570342 13:100588471-100588493 GCGATTGCCAGAACGGGCAGAGG - Intronic
1112680956 13:101764241-101764263 GAGACCTCCAGCAGGGGCAGAGG - Intronic
1114579958 14:23748387-23748409 CATGCTCCCAGGACTGGCAGCGG - Intergenic
1115375057 14:32665488-32665510 GACACGCCCAGGAAGGGCATGGG - Intronic
1118444449 14:65838782-65838804 GAGACTTAGAGGACGGACAGTGG - Intergenic
1118737020 14:68708471-68708493 GAGAGTCCCAAGAAGGCCAGTGG - Intronic
1118849124 14:69571421-69571443 GGGACTCCCACGATGGTCAGTGG + Exonic
1121529194 14:94640727-94640749 GAGAGCCCCAGGAGTGGCAGCGG - Intergenic
1121731191 14:96188304-96188326 GAGAGTTCCAGGACTAGCAGAGG + Intergenic
1122241131 14:100368400-100368422 GAGACTGCCTGGACGGGAAGTGG + Intronic
1122277880 14:100604498-100604520 GGGGCTCCCAGGACAGGCTGTGG + Intergenic
1122465857 14:101933100-101933122 GAGACTGGCATGAGGGGCAGAGG + Intergenic
1122789710 14:104179097-104179119 GGGGCTCCAAGGGCGGGCAGGGG - Intronic
1122863683 14:104593946-104593968 GAGGCCCCGAGGAGGGGCAGTGG + Intronic
1122981339 14:105193577-105193599 GGGGCTCCCTGGAAGGGCAGTGG - Intergenic
1123062321 14:105599850-105599872 GGGCCCCCCAGGAGGGGCAGTGG - Intergenic
1123068172 14:105628474-105628496 GAGGGTGCCAGGACAGGCAGGGG - Intergenic
1123072179 14:105647253-105647275 GAGGGTGCCAGGACAGGCAGGGG - Intergenic
1123087063 14:105721578-105721600 GGGCCCCCCAGGAGGGGCAGTGG - Intergenic
1123092186 14:105746770-105746792 GAGGGTGCCAGGACAGGCAGGGG - Intergenic
1123097762 14:105774471-105774493 GAGGGTGCCAGGACAGGCAGGGG - Intergenic
1123123664 14:105929600-105929622 GAGCCTCACAGGATGGACAGTGG - Intronic
1123406302 15:20021100-20021122 GAGCCTCACAGGACGGACAGTGG - Intergenic
1123476476 15:20595126-20595148 GAGATTCCCAGGAGGCCCAGGGG + Intergenic
1123515632 15:21027748-21027770 GAGCCTCACAGGACGGACAGTGG - Intergenic
1123641535 15:22405238-22405260 GAGATTCCCAGGAGGCCCAGGGG - Intergenic
1124607140 15:31178175-31178197 GAAGCTCCCAGGGCGGGGAGTGG - Intergenic
1125755719 15:42063380-42063402 GAGGCTCCCAGTATTGGCAGAGG - Intergenic
1128081788 15:64861357-64861379 GAGATTCCCAGAGAGGGCAGCGG + Intronic
1128516901 15:68348105-68348127 GAGCCTCCCAGGACTGCAAGGGG - Intronic
1129224274 15:74157799-74157821 GAGATTCCCAGGAAAGACAGAGG - Intergenic
1129713936 15:77836182-77836204 GACAGTCCCAGGACTGACAGCGG + Intergenic
1131265218 15:90911582-90911604 GAGGGGCCCACGACGGGCAGAGG - Intronic
1132115678 15:99134264-99134286 GAGATACCCAGGACGGGCCTGGG + Exonic
1132478590 16:154412-154434 GGGACCCCCAGGACAGGCTGCGG + Exonic
1132480769 16:165168-165190 GGGACCCCCAGGACAGGCTGCGG + Intronic
1132689002 16:1174161-1174183 GAGTCTCCAAGGAAGGGCAGAGG + Intronic
1132832071 16:1933309-1933331 GAGCCACCCGGGGCGGGCAGGGG - Intergenic
1134008903 16:10836706-10836728 GAGGCTCTCAGGACTGCCAGTGG + Intergenic
1135708032 16:24691872-24691894 GAGAAGCCCAGGACTGACAGCGG + Intergenic
1136378110 16:29877237-29877259 TAGAGTCCCGGGATGGGCAGGGG - Intronic
1137578080 16:49617100-49617122 CAGACACCCAGGAAGGGCAGGGG + Intronic
1137614676 16:49839236-49839258 GAGATTTCCAGGACGGGAGGTGG - Intronic
1139511407 16:67430472-67430494 GAGACTCCAAGAACCGGGAGCGG + Intergenic
1141799346 16:86296402-86296424 GACACTCCCAGCACGGTCAGTGG + Intergenic
1142029792 16:87832826-87832848 GTCCCTCCCAGGTCGGGCAGTGG - Exonic
1143103190 17:4515074-4515096 GAGGGTCACAGGCCGGGCAGGGG + Intronic
1143392128 17:6565587-6565609 GAGACTCTGAGGAGAGGCAGTGG - Intergenic
1143770155 17:9163313-9163335 GAGAAGCCCAGGAGGGGGAGGGG - Intronic
1147137911 17:38444676-38444698 GAGACTCTGAGGAGGTGCAGTGG + Intronic
1147450305 17:40500213-40500235 CAGAATCCCAGAAGGGGCAGCGG - Intronic
1148832250 17:50441207-50441229 GAGACACCCAGGCTGTGCAGTGG + Intronic
1151176552 17:72293356-72293378 GAGACTCCCAAGATAGGCAAGGG - Intergenic
1152009071 17:77699747-77699769 GAAACTCCCAGGACATGCAAGGG + Intergenic
1152420035 17:80187736-80187758 GCCACACCCAGGACGGGAAGAGG + Intronic
1152433272 17:80260920-80260942 GAGTCTCCCGGGGCGGGGAGCGG + Intronic
1153919239 18:9773515-9773537 GAGACAGGCAGGAAGGGCAGAGG - Intronic
1155045319 18:22098027-22098049 GACACTCCTAGCACAGGCAGTGG + Intronic
1155074437 18:22342314-22342336 CAGTCTCCCAGGAAGGCCAGTGG - Intergenic
1160196230 18:76758030-76758052 GAGACTTCCAGCACGGACAGCGG - Intergenic
1160796558 19:948360-948382 GAAACTCCCAGGACTGACAGAGG - Intronic
1160811415 19:1014565-1014587 GGGACGCCCAGGACGGGGAAAGG + Intronic
1160853383 19:1205528-1205550 GAGACGCCCGTCACGGGCAGGGG - Intronic
1160943783 19:1631886-1631908 GCTGCTCCCAGGACGGGCAGAGG + Intronic
1160968838 19:1758510-1758532 GAGGCACGCAGAACGGGCAGTGG - Intronic
1161171774 19:2815718-2815740 GTGACAACCTGGACGGGCAGGGG - Exonic
1161251188 19:3281184-3281206 GAGGCTCCCTGCAGGGGCAGCGG - Exonic
1161557807 19:4954443-4954465 GCGTCCCCCAGGACGGGCAAGGG + Exonic
1162367816 19:10259844-10259866 GAGGCTCCCAAGTCGGCCAGGGG - Exonic
1163007625 19:14406496-14406518 GAGACGCCCACGATGAGCAGGGG - Exonic
1163209001 19:15826603-15826625 TTGAATCCCAGGGCGGGCAGAGG - Intergenic
1163786431 19:19277234-19277256 GAGACCCCCGGGGCGGGCGGGGG + Intronic
1164639483 19:29813203-29813225 TGGAATCCCAGGACTGGCAGAGG - Intronic
1165206431 19:34192224-34192246 GAGACTTCCAGGAAAGACAGTGG - Intronic
1166133756 19:40763061-40763083 GATACTCACAGGCTGGGCAGGGG - Exonic
1166641687 19:44499578-44499600 GACACCCCCAGGACGTGCAGGGG + Intronic
1166818646 19:45562647-45562669 GTGTCTCCCAGGCTGGGCAGTGG - Intronic
1166955051 19:46458228-46458250 GAGACACACAGGGAGGGCAGGGG + Intergenic
1167377159 19:49118343-49118365 GAGACTCCAAGGACCTGCAAGGG - Exonic
927846023 2:26473319-26473341 GAGCCTCCAAGAAGGGGCAGAGG + Intronic
927882358 2:26697676-26697698 AAGATTCCCAGGACCTGCAGTGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928196198 2:29218338-29218360 GGGACCCCCAGAACGGGGAGGGG - Intronic
930933719 2:56920442-56920464 GAGAGTCTCAGGACGGGGATTGG + Intergenic
933777230 2:85778580-85778602 GAGACTCCCAGGACGGAGCCCGG - Intronic
937310515 2:120900009-120900031 CAGGCTCCCAGGACATGCAGAGG + Intronic
937983518 2:127628371-127628393 GGGAGGCCCAGGGCGGGCAGAGG + Exonic
939878942 2:147608324-147608346 GCTACCCCCAGGAAGGGCAGAGG + Intergenic
943770701 2:191713279-191713301 GAGAATGCCTGGACTGGCAGAGG + Intergenic
947144978 2:227056023-227056045 CGGACTCCCAGGACGGCCTGGGG - Exonic
948605489 2:239132059-239132081 GAGACACTGAGGACGGACAGGGG + Intronic
1169212897 20:3777700-3777722 TAAGCTCCCAGGAGGGGCAGGGG + Exonic
1171976229 20:31596315-31596337 AAGACTCCTAGGAGGGGCAGTGG + Intergenic
1172115042 20:32568687-32568709 GGGAAGCCCAGGTCGGGCAGGGG - Intronic
1172315980 20:33954785-33954807 TAGACTCCCAGGTCGGCCTGAGG - Intergenic
1172439616 20:34956137-34956159 GAGGCCCCAAGGAGGGGCAGGGG + Intergenic
1172644466 20:36461361-36461383 GGGACTCCCGGGCCGGGCAGGGG - Intronic
1172763182 20:37336375-37336397 AAGACTTCCAGGAGGGGCCGGGG + Intergenic
1173994992 20:47331120-47331142 GAGACTAGCAAGATGGGCAGAGG + Intronic
1175400781 20:58698824-58698846 TAGACTCCCAGGAGAGCCAGAGG + Intronic
1175404319 20:58716901-58716923 GAGACACCCAGAAGAGGCAGAGG + Intronic
1178741047 21:35201609-35201631 GAGAATCCCAGGAAGAGAAGAGG - Intronic
1179138396 21:38700526-38700548 CTGACTCCCAGGACGGCAAGAGG + Intergenic
1179813353 21:43886184-43886206 GGGACTGCCAGGAGGAGCAGAGG - Intronic
1180006980 21:45027403-45027425 GAGACTCTCAGGACGGACAGAGG + Intergenic
1180699284 22:17773058-17773080 GGATCTCCCAGGACGGGCACAGG - Intronic
1181571172 22:23768390-23768412 GAGACTCCCAGGCCACGCGGTGG - Exonic
1181783173 22:25207450-25207472 GAGACTCCCAGGAAGGGGCTGGG + Intergenic
1183278076 22:36913847-36913869 CAGACTCCTAGGGCGGCCAGTGG + Intronic
1183482636 22:38073643-38073665 GGGAGTCCCAGAGCGGGCAGCGG - Intronic
1183604071 22:38858584-38858606 GGGAGTCCCAGGAGGGACAGAGG - Intergenic
1183726770 22:39594301-39594323 GAAACTGGCAGGAGGGGCAGAGG + Intronic
1184250374 22:43256801-43256823 GAGAGCCCCAGGCCGGACAGTGG + Intronic
1184690465 22:46115041-46115063 GAGACTCTGAGGCCTGGCAGTGG - Intergenic
949414661 3:3800950-3800972 GGGACTCCCTGGGCGGGCGGCGG - Intronic
949550058 3:5105120-5105142 GATACCCCCAGGAGGGGGAGGGG - Intergenic
952966288 3:38623095-38623117 GAGATTCCCAGGTGGAGCAGAGG - Intronic
956767044 3:72492619-72492641 GAGACTCCCTGGACTGGCTGGGG - Intergenic
959884900 3:111488191-111488213 GAGAATCCCTGGCAGGGCAGTGG - Intronic
960668898 3:120137794-120137816 GAAGCTGCCAGGACAGGCAGTGG + Intergenic
961821806 3:129579045-129579067 GATACTCCCAGGAAGGGCCCCGG + Intronic
962932498 3:140051089-140051111 GAGGCCCCAAGGATGGGCAGGGG - Intronic
963903159 3:150751927-150751949 GAGACTCCCAGGGCTGGCAGGGG + Intronic
967293643 3:187945252-187945274 GTGACTCCCAGGACTGGTGGCGG - Intergenic
968230743 3:197003325-197003347 GAAACTCCCCGGGCGGGCATCGG + Exonic
968605785 4:1534695-1534717 GTGACACCCAGGAAGGGCTGGGG - Intergenic
968737209 4:2303701-2303723 GAGAGTCCTGGGAGGGGCAGAGG + Intronic
969397173 4:6929596-6929618 GAGGCGCTCAGGAGGGGCAGGGG + Intronic
972688418 4:41373206-41373228 GAGACCCCAAGGATGAGCAGGGG + Intronic
975481141 4:74881778-74881800 CAGAATCCCAGGAGAGGCAGAGG + Intergenic
977910833 4:102534173-102534195 GCCACTCCCAGGAAAGGCAGAGG + Intronic
982066921 4:151662512-151662534 GAGGCTTCCAGGACAGGAAGTGG + Exonic
982275772 4:153635927-153635949 GAAAGTCCCAGGAAGGTCAGTGG + Intronic
982670397 4:158313874-158313896 CAAACACCCAGGATGGGCAGTGG + Intergenic
983418343 4:167485848-167485870 CAGACTTCCAGGTCGGGGAGGGG + Intergenic
985487134 5:158200-158222 GAGACCCCCAGGATGGGCAGGGG - Intronic
985487153 5:158241-158263 GAGACCCCCAGGATGGGCAGGGG - Intronic
985487168 5:158281-158303 GAGACCCCCAGGATGGGCAGAGG - Intronic
985487181 5:158321-158343 GAGACCCCCAGGATGGGCAGAGG - Intronic
985487194 5:158361-158383 GAGACCCCCAGGATGGGCAGAGG - Intronic
985487216 5:158441-158463 GAGACTCCCAGGACGGGCAGAGG - Intronic
985487230 5:158478-158500 GAGACCCCCAGAATAGGCAGTGG - Intronic
985487261 5:158560-158582 GAGACTCCCAGGACGGGCAGAGG - Intronic
985670092 5:1202514-1202536 GTGGCTCCCAGGCCTGGCAGGGG + Intronic
985766992 5:1785329-1785351 AAGAGTCACAGGACAGGCAGGGG - Intergenic
985819449 5:2149700-2149722 GTGTCTCCCAGGCAGGGCAGAGG - Intergenic
986771940 5:10982306-10982328 CAGACCCAAAGGACGGGCAGGGG + Intronic
987116980 5:14733450-14733472 GAGACACCCAGGCCTGGGAGAGG + Intronic
999022992 5:148191264-148191286 GAGACACCCTGGGCTGGCAGTGG - Intergenic
999323179 5:150627081-150627103 GTGCCTCCCAGGCCAGGCAGGGG - Intronic
1001228206 5:169963660-169963682 GAGACTCCCAAGACTGGGTGAGG - Intronic
1001520167 5:172385655-172385677 GGGCCTCCCAGGATGGGCAGAGG + Intronic
1001636135 5:173211592-173211614 GGGCCTCCCAGCACGGGCAAAGG + Intergenic
1006080049 6:31559868-31559890 GAGAATCCCAGGAGTGGAAGTGG + Intergenic
1006470638 6:34226873-34226895 GGGACTCCCTGGAAGAGCAGTGG - Intergenic
1006641280 6:35491016-35491038 GAGACAGACAGGAGGGGCAGGGG + Intronic
1019340312 7:505811-505833 GAGACACCCAGGTGGGGCTGTGG - Intronic
1019518793 7:1451325-1451347 CAGGCTCCCAGCACGGGCTGCGG + Intronic
1019544968 7:1569851-1569873 CACACTGCCAGGCCGGGCAGTGG + Exonic
1020092013 7:5346950-5346972 GGGATGCCCAGGAAGGGCAGGGG + Intronic
1023088365 7:36594880-36594902 GAGACCCCCAAGAAGGTCAGAGG - Intronic
1024025741 7:45408479-45408501 GAGGCTCCCAGGAGAGGCAAAGG - Intergenic
1024810256 7:53202801-53202823 GAGACTCACAGGAAGAGCAATGG + Intergenic
1024969097 7:55052522-55052544 GACACAGCCAGCACGGGCAGGGG - Intronic
1029202184 7:98846641-98846663 GAGCCTGTCAGGAAGGGCAGGGG - Exonic
1032239931 7:130152921-130152943 CAGACTCCCACGCAGGGCAGGGG - Intergenic
1032751661 7:134847432-134847454 GAGACTCCCAGGGAAGGGAGTGG - Intronic
1034129130 7:148699257-148699279 GAGTCACCCCGGACGGGCCGGGG + Intronic
1034527608 7:151675646-151675668 GAAACACCAAGGACGGTCAGAGG + Intronic
1038732444 8:30139347-30139369 CAGACTTCCAGGACGGTCAGGGG - Intronic
1038790982 8:30668065-30668087 GAGACACCCAGGAAGCACAGGGG - Intergenic
1039559467 8:38501149-38501171 GAGACTCACAGAACTGGGAGTGG + Intergenic
1039981134 8:42410834-42410856 GAGCCTCCGAGGACAGGCACAGG - Intergenic
1040452434 8:47561657-47561679 GAGGATCCCAGGAGGGGCAGGGG - Intronic
1042217341 8:66439414-66439436 GAGACGACCAGGACAGGAAGAGG + Intronic
1042350403 8:67771710-67771732 GAGACTCCCAGGACAAACACAGG - Intergenic
1042762481 8:72285963-72285985 GAGGGTCCCAGTAGGGGCAGCGG + Intergenic
1045876422 8:106986362-106986384 GAGACTCACAGGATGGCCAGGGG + Intergenic
1046721123 8:117620269-117620291 GAGACTCACAGGGGGGGAAGAGG - Intergenic
1049373435 8:142278361-142278383 CAGCCTCACAGGACAGGCAGGGG - Intronic
1050106740 9:2173712-2173734 GAGATTCCCAGTACAGCCAGAGG + Intronic
1050306890 9:4313759-4313781 GAGACTCCCAGGGAAGGCTGCGG - Intronic
1052051258 9:23851391-23851413 GAGACTCCCAAGTCGGGCGAGGG + Intergenic
1052088412 9:24295986-24296008 GAGAGTGCCAGGCAGGGCAGTGG - Intergenic
1052521268 9:29550639-29550661 GAGACTCCCATGAGGGGTGGTGG + Intergenic
1054718402 9:68580259-68580281 GAGAGACCCAGGACAGCCAGCGG - Intergenic
1056708747 9:88973003-88973025 GAGACTCCCCCCACCGGCAGGGG - Intergenic
1056932328 9:90889538-90889560 GATACTCCCAGGGTGGGGAGGGG - Intronic
1057182565 9:93037920-93037942 GCCACTCCATGGACGGGCAGTGG - Intergenic
1057410449 9:94812685-94812707 GAGACCCATAGGAAGGGCAGGGG - Intronic
1057442311 9:95091299-95091321 GAGCCTCCCAGGACAGACTGTGG - Intergenic
1057454758 9:95198035-95198057 AAGACTCCTAGGATGGGCAAAGG + Intronic
1061400500 9:130365732-130365754 GGGTCTCCCAGGCTGGGCAGGGG + Intronic
1061739331 9:132688912-132688934 GAGAATCACAGAAAGGGCAGGGG - Exonic
1061859713 9:133461668-133461690 GGAACTCCCAGGAAAGGCAGAGG - Intronic
1062010856 9:134265931-134265953 GGGGCTCCCTGGAGGGGCAGGGG - Intergenic
1186397186 X:9221999-9222021 GAGAGCCGCAGGAAGGGCAGAGG + Intergenic
1187698916 X:21946223-21946245 GAGACCCCCAGGCTGGGGAGGGG + Intronic
1190878953 X:54479258-54479280 GAGATTCCCAGGAAGGGTTGAGG - Intronic
1196124596 X:112084085-112084107 TAGGCTCCCAGGGCGTGCAGAGG - Intergenic
1198972045 X:142292765-142292787 GAGACTCCCAGGTCATGCAGAGG - Intergenic
1200684679 Y:6247681-6247703 GTGGCTCCCAGGATGGGTAGTGG + Intronic
1200990209 Y:9338946-9338968 GTGGCTCCCAGGATGGGTAGTGG + Intronic
1200992871 Y:9359261-9359283 GTGGCTCCCAGGATGGGTAGTGG + Intronic
1200995524 Y:9379539-9379561 GTGGCTCCCAGGATGGGTAGTGG + Intronic
1200998190 Y:9399885-9399907 GTGGCTCCCAGGATGGGTAGTGG + Intronic
1201000699 Y:9468419-9468441 GTGGCTCCCAGGATGGGTAGTGG + Intronic
1201003365 Y:9488749-9488771 GTGGCTCCCAGGATGGGTAGTGG + Intronic
1201006021 Y:9509031-9509053 GTGGCTCCCAGGATGGGTAGTGG + Intergenic
1201008679 Y:9529344-9529366 GTGGCTCCCAGGATGGGTAGTGG + Intronic