ID: 985487301

View in Genome Browser
Species Human (GRCh38)
Location 5:158679-158701
Sequence CAGGACAGGCAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1411
Summary {0: 1, 1: 1, 2: 15, 3: 146, 4: 1248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985487301_985487315 21 Left 985487301 5:158679-158701 CCTTCCTCCCTCTGCCTGTCCTG 0: 1
1: 1
2: 15
3: 146
4: 1248
Right 985487315 5:158723-158745 TTCCTCGTTCTACTCCTTCCTGG 0: 1
1: 0
2: 0
3: 21
4: 222
985487301_985487318 23 Left 985487301 5:158679-158701 CCTTCCTCCCTCTGCCTGTCCTG 0: 1
1: 1
2: 15
3: 146
4: 1248
Right 985487318 5:158725-158747 CCTCGTTCTACTCCTTCCTGGGG 0: 1
1: 0
2: 4
3: 15
4: 170
985487301_985487316 22 Left 985487301 5:158679-158701 CCTTCCTCCCTCTGCCTGTCCTG 0: 1
1: 1
2: 15
3: 146
4: 1248
Right 985487316 5:158724-158746 TCCTCGTTCTACTCCTTCCTGGG 0: 1
1: 1
2: 1
3: 24
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985487301 Original CRISPR CAGGACAGGCAGAGGGAGGA AGG (reversed) Intronic
900018480 1:170734-170756 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900048738 1:529329-529351 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900070969 1:771153-771175 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900122227 1:1053687-1053709 CAGGACAGGGTGGGGGAGGCGGG - Intronic
900204721 1:1427076-1427098 CAGGGCGGGAAGAGGGAGGGGGG - Intronic
900315058 1:2052268-2052290 AAAGCAAGGCAGAGGGAGGACGG - Intronic
900334107 1:2152819-2152841 CCGGCCAGGCAGAGAGAGGAAGG - Intronic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900391611 1:2436276-2436298 GAGGAAAGGAGGAGGGAGGAAGG - Intronic
900391629 1:2436328-2436350 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391649 1:2436381-2436403 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391656 1:2436403-2436425 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391671 1:2436448-2436470 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391693 1:2436510-2436532 GAGGAAAGGAGGAGGGAGGAAGG - Intronic
900391706 1:2436547-2436569 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
900600424 1:3500408-3500430 CAGGAAAGGCAGAGGAAGCCAGG + Intronic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901063900 1:6485801-6485823 CGGGCCAGGCAGAGGTGGGAAGG - Intronic
901069309 1:6509299-6509321 CAGGACAGGCAGAGGGACAGGGG + Intronic
901403863 1:9032949-9032971 CAGGAATAGCAAAGGGAGGAAGG + Intergenic
901530868 1:9851773-9851795 CAGGACAGGCAGTGGCAGGAGGG + Intronic
901675085 1:10878625-10878647 GGGGACAGTCAGAGGCAGGAGGG + Intergenic
901750033 1:11400402-11400424 CTGGACAGGGAGAGGTGGGACGG + Intergenic
901804585 1:11730061-11730083 CAGGACAGGCCATGGGAGGCGGG + Intergenic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902774662 1:18666949-18666971 CAGGATAGGCTGAGGGAGTGGGG + Intronic
902780499 1:18701829-18701851 AGGGATAGGCAGAGGGAAGAAGG + Intronic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903061731 1:20673315-20673337 CAGGACAGCCACAGAGAGGCTGG + Intronic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903823545 1:26123582-26123604 CAGGGCAGGCAAAGTGAGGGTGG - Exonic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904263940 1:29306998-29307020 CAGGGCAGGCAGAGCGGAGACGG - Intronic
904269028 1:29336979-29337001 CAGGACTGGAAGATGGAAGAGGG + Intergenic
904329305 1:29747519-29747541 CAGCTCAGGGAGAGGTAGGAGGG - Intergenic
904599428 1:31665495-31665517 CAGGCCAGGCTGGGGTAGGATGG - Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
904840139 1:33367351-33367373 CAGGACAGGCTGAGTGGGGGTGG + Exonic
904966468 1:34378220-34378242 GAGGCCAGGCATAGAGAGGAAGG - Intergenic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
905015669 1:34776975-34776997 CAGATCAGGCAGAGGGATGGGGG - Intronic
905292791 1:36934243-36934265 CATGCCAGCCAGAGGGAGGGAGG - Intronic
905462016 1:38128117-38128139 GAGGACAAGGAGGGGGAGGAAGG + Intergenic
905901237 1:41583184-41583206 CAGGAGAGGCACAGGGGGGGCGG + Exonic
906058654 1:42934533-42934555 CAGGAAAGGCAGGGGGATGCTGG + Intronic
906153430 1:43600811-43600833 GAGGAATGGCAGGGGGAGGAGGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906316025 1:44786847-44786869 GAGGCCAGGAGGAGGGAGGAGGG + Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907237701 1:53062971-53062993 CGGGACAGCTGGAGGGAGGAAGG + Intronic
907313603 1:53553851-53553873 CAGAACGGGCAGGTGGAGGATGG + Intronic
907393671 1:54175020-54175042 CAGCAGAGGCACAGGGAAGAGGG + Intronic
907431456 1:54414482-54414504 CATTACAGCCAGAGGAAGGAAGG - Intergenic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
908151871 1:61310787-61310809 CAGGAAATTCAGAGGAAGGAAGG - Intronic
908677303 1:66619650-66619672 CAGGACAAGGAGAGAAAGGAGGG + Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909344818 1:74572695-74572717 CAGGAGAGGCAGAGGCAAGCCGG - Exonic
909366491 1:74829449-74829471 CAGCACATGAAGAGGGATGAGGG - Intergenic
909456370 1:75854316-75854338 CAGCATAGGCAGAGTGAAGATGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911127471 1:94353833-94353855 AAGAACAGGCTGAGAGAGGATGG - Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
912595354 1:110870661-110870683 TGGGACAGGCAGAGAGAGTAAGG - Intergenic
912763086 1:112386237-112386259 CAGGAAGGGTAGGGGGAGGAGGG + Intergenic
912823472 1:112885540-112885562 CAGCACTGGCAGAGGGGAGAAGG + Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914044643 1:144080533-144080555 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
914133467 1:144880153-144880175 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914221205 1:145683495-145683517 AAGGACAGGCACAGGAGGGAGGG + Intronic
914473775 1:148006368-148006390 AAGGACAGGCACAGGAGGGAGGG + Intergenic
914675557 1:149904940-149904962 CAGGGCAGGGAGGGGAAGGAAGG + Exonic
914830509 1:151167423-151167445 CGGGAAAGCCAGAGGTAGGAAGG + Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915286375 1:154855992-154856014 CAGGGCGGGGAGAGGGAGCATGG - Intronic
915325844 1:155080799-155080821 CTGGGCCGGCAGAGGTAGGAGGG + Intronic
915361670 1:155289677-155289699 GGGGACAGGCAGAGTGAGGGTGG - Exonic
915388471 1:155518784-155518806 CAGGAGAGGTAGAGGGGAGACGG + Intronic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915734720 1:158077535-158077557 CAAGGCAGGCCCAGGGAGGAAGG - Intronic
915941009 1:160118061-160118083 CAGGACAGGAGGAGGGGGAAGGG + Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916445536 1:164868467-164868489 CAGGAAAGGTAGAGAGAGAAAGG + Intronic
916548376 1:165827799-165827821 TCGCACAGGCAGCGGGAGGAGGG + Exonic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916860660 1:168801092-168801114 CAGGAGAGGGAGAGAGAGCAGGG + Intergenic
916923379 1:169492315-169492337 GAAGACAGGCAGAGTCAGGAGGG - Intergenic
917123794 1:171668014-171668036 CACGACTGGAAGAAGGAGGAAGG + Intergenic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917849562 1:179049343-179049365 CTGGACTGGCAGTGGGAGGTTGG - Intronic
917854533 1:179090032-179090054 AAGGACAGGCAGCTGGAGGGTGG - Intronic
917927875 1:179803979-179804001 CAGGCCAGGCGGCAGGAGGAGGG + Intronic
917928759 1:179809608-179809630 CAGCACAGGGGCAGGGAGGAGGG + Intronic
917976814 1:180245145-180245167 GAAGAAAGGCTGAGGGAGGAGGG - Intronic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918204341 1:182295900-182295922 CAAGAGAGACAGAGGAAGGAAGG - Intergenic
918289310 1:183091477-183091499 GAGGAAGGGCAGAGGGAGGGAGG - Intronic
918290150 1:183099587-183099609 GGGGGCAGCCAGAGGGAGGAAGG - Intronic
919791821 1:201296146-201296168 CAGGAGAGGCTGTGGGAAGAGGG + Intronic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919896451 1:202012454-202012476 CAAGACAGGCTGGGGAAGGAAGG - Intronic
920054706 1:203183610-203183632 CAGGTCAGGGACAGGGAGGGAGG - Intronic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920311967 1:205053927-205053949 GAGGAGAGGCAGAGGAAGGCTGG + Intronic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920513231 1:206565954-206565976 CATGACAGGCAGGGGAAGGAAGG + Intronic
921070459 1:211654131-211654153 GAGTCCAGGCAGTGGGAGGAGGG + Intergenic
921598744 1:217084155-217084177 CAGGAAAGAAAGAGGAAGGAAGG + Intronic
921759713 1:218899048-218899070 AAGAGCAGGCAGAGAGAGGAAGG - Intergenic
922106333 1:222516603-222516625 GAGGACAGGCAGGGGCAGGAGGG + Intergenic
922537362 1:226391107-226391129 CAGGCAAGGCCGAGGTAGGAGGG - Intronic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
923009306 1:230075470-230075492 CAGGACAGGCAGAGGCCTGGAGG - Intronic
923364404 1:233245494-233245516 CAAGAAGGGCTGAGGGAGGAGGG + Intronic
923718608 1:236448252-236448274 CAGCACAGCCAGAGTGAGGAAGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923935701 1:238757314-238757336 AAGGACGGAGAGAGGGAGGAAGG + Intergenic
924348513 1:243094168-243094190 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
924701980 1:246463343-246463365 CAGGTCAGGGAGAGGGAGAGAGG + Intronic
924740159 1:246790206-246790228 CAGGACAGGCAGATGGGGATTGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1063067412 10:2623750-2623772 CATGACAGGGAGAGGGAAGCAGG + Intergenic
1063366935 10:5496663-5496685 CAGCCCAGGCAGAGGAGGGAAGG + Intergenic
1063434343 10:6018308-6018330 GAGGACAGGGTGAGGGTGGAGGG + Intronic
1063600043 10:7472961-7472983 CAGGACAGTCAGGGTGAGAAAGG - Intergenic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1063692089 10:8296756-8296778 AAGGAAAGGAAGAGGAAGGAAGG - Intergenic
1063790985 10:9447534-9447556 AAAGACAGGGAGAGAGAGGAAGG - Intergenic
1064216049 10:13401510-13401532 CAGAACAGGAAGAGAGAGGGTGG + Intergenic
1065219252 10:23479399-23479421 GAGGAAAGGGAGAGGGAAGAGGG - Intergenic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065658778 10:27983012-27983034 AAAGGCTGGCAGAGGGAGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066435266 10:35391803-35391825 GATAACAGGAAGAGGGAGGAGGG - Intronic
1066598498 10:37078147-37078169 AGGGGCAGGGAGAGGGAGGAAGG - Intergenic
1066727846 10:38410733-38410755 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1067228075 10:44388180-44388202 CAGGCCAGGCAGAGGGGGGTAGG - Intergenic
1067530681 10:47069395-47069417 AAGGAGAGGCAGAGGGAGACAGG - Intergenic
1067792615 10:49299433-49299455 CTGGACACGCAGAGAGCGGAAGG + Intronic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068100045 10:52541417-52541439 CAGGAAAGGCACAGAGAGCAAGG + Intergenic
1068114139 10:52718245-52718267 TAGTACAGGCAGAGATAGGATGG + Intergenic
1068946091 10:62730238-62730260 TGGGACAGCCAGAGGGAGGATGG - Intergenic
1068983322 10:63084177-63084199 CAGGACACCCTGTGGGAGGAGGG + Intergenic
1069135005 10:64752887-64752909 CAGGACAGACAGAGGATTGAGGG + Intergenic
1069160227 10:65083908-65083930 CAGCACCGGCAGAGGGTGGTAGG + Intergenic
1069591557 10:69645214-69645236 CAGGAAAGGTGAAGGGAGGAGGG - Intergenic
1069619044 10:69825001-69825023 CAGGTCAGTCAGAGAGAGGCAGG - Intronic
1069773928 10:70916009-70916031 CGGGTCAGGGAGAGGGAGGCTGG + Intergenic
1069797311 10:71061693-71061715 CAGCAAAGGCTGAGAGAGGAGGG - Intergenic
1069895968 10:71680241-71680263 CTGGACAGCCAAAGGGAGGCAGG - Intronic
1069996115 10:72343125-72343147 CAGGAAATGCAGAGGAAGCAGGG + Intronic
1070109334 10:73467804-73467826 CAGGGCTGGTAGAGGGAGGAAGG + Intronic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070397644 10:76025349-76025371 CAGGACAAGCATAGGAGGGATGG + Intronic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070696983 10:78570823-78570845 AGGGCCAGGCAGAGTGAGGATGG - Intergenic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1070853357 10:79585249-79585271 CAGGCCAGGCACAAGGAGAAGGG + Intergenic
1071468516 10:85962045-85962067 GAAGAAAGGCAGAGGGAGGGAGG + Intronic
1071494878 10:86161376-86161398 CAGGACAGGCAGCTGCGGGAAGG + Intronic
1072255548 10:93617043-93617065 GAGGAAAGGAAGAGAGAGGAAGG - Intronic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1072909218 10:99485044-99485066 CAGCACAGGCAAAGGCACGAAGG + Intergenic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073319022 10:102602763-102602785 CCGGGAAGGCAGTGGGAGGAGGG - Intronic
1073441234 10:103553866-103553888 CAGGCCAGGGCCAGGGAGGATGG + Intronic
1073545816 10:104347942-104347964 CAGGAGAGGCAGAGAAAGGCAGG - Intergenic
1073570493 10:104576962-104576984 CATGACAGGCAGATGGAGCCAGG - Intergenic
1074749136 10:116567019-116567041 AAGGACAGAGGGAGGGAGGAAGG - Intronic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1075016108 10:118910922-118910944 CAGGCCAGGCAGTGGGGTGAGGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075164099 10:120051523-120051545 GAGGAAAGGCAGAGGGAAGGAGG + Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1075619745 10:123917033-123917055 CAGGACAGGAAGGGAGGGGAGGG + Intronic
1075647651 10:124107249-124107271 CAGGACAGGCAGGGGTGGGCCGG - Intergenic
1075663187 10:124212470-124212492 AAAGAAAGGCAGAGGAAGGAAGG - Intergenic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1076006034 10:126948828-126948850 CAGGAAAGGCATAGGGGGCAAGG - Intronic
1076055408 10:127368376-127368398 CAGGACAGGAAGAAGCAGCAGGG - Intronic
1076120483 10:127933028-127933050 CAGGAGAGCCAGAGAGATGAGGG - Intronic
1076435609 10:130439159-130439181 CAAAACAGGCAGCGGGAGGGGGG - Intergenic
1076520698 10:131079098-131079120 CTGGACAGGCCGAGCTAGGAGGG + Intergenic
1076569688 10:131424555-131424577 CAGAACTGGCAGAGTGAGGGTGG + Intergenic
1076676062 10:132148442-132148464 GAGGACGGGCAGATGGAGGACGG - Intronic
1076676066 10:132148457-132148479 GAGGACGGGCGGATGGAGGACGG - Intronic
1076676082 10:132148506-132148528 GAGGACGGGCGGATGGAGGACGG - Intronic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076934000 10:133555439-133555461 CTGGACAGGAAGAGGTAGGATGG + Intronic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077111903 11:865657-865679 CAGGTCGGGCTGAGGCAGGAGGG - Intronic
1077137175 11:1006270-1006292 CAGGAGGGGCCGAGGGAGGAGGG + Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077163264 11:1123143-1123165 AAGGAAAGACGGAGGGAGGAAGG - Intergenic
1077189948 11:1251792-1251814 CAGGACAGGCAGACCCAGGTTGG - Intronic
1077301922 11:1851472-1851494 GAGGACAGGCAGGTGGAGGCTGG - Intergenic
1077337507 11:2012016-2012038 CTGGTCTGGCAGAGGGAGGGCGG + Intergenic
1077393938 11:2312052-2312074 CAGGGCAGGCAGAGCCAGGCAGG + Intronic
1077412172 11:2408700-2408722 CGGGGCAGGAGGAGGGAGGAGGG + Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078081537 11:8207749-8207771 CAGGATAGGGACAGGGATGACGG - Intergenic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078219156 11:9336868-9336890 CAGGACAGGCATAGTCAGGTTGG - Intergenic
1078322188 11:10346304-10346326 CCAGACAGGGAGAGGGAGAAGGG - Intronic
1078528241 11:12117041-12117063 CAGGACAGCCACTGGGAGGTGGG - Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080248152 11:30203031-30203053 CAAGACAGCCAGATGGAAGAGGG - Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080656045 11:34259191-34259213 GAGGACAGGCAGAGAGCAGAGGG - Intronic
1080883568 11:36345201-36345223 CAGGATAGGTAGAGGAAGAAGGG + Intronic
1081284090 11:41246365-41246387 CAGAACAGGCACTGGGAGTAGGG + Intronic
1081339113 11:41905213-41905235 GAAGACAGGAAGAGGCAGGAAGG - Intergenic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081762317 11:45584967-45584989 GAGGACAGGCAGAAGAAGGTAGG - Intergenic
1081977244 11:47243392-47243414 CAGGCCTGGCAGAGGGTGAAAGG - Intronic
1082000861 11:47393168-47393190 CTGGCCAGGCAGTGGGAGGTGGG + Intergenic
1082004845 11:47413812-47413834 CAGGACAGCAGCAGGGAGGATGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083300106 11:61735679-61735701 GAGGACAGGAAGAGGGAGGCAGG - Intronic
1083597363 11:63924596-63924618 CAGGAGGGGCAGTGGGAGAAGGG - Intergenic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083683329 11:64361288-64361310 CAGAGCAGGAAGAGGCAGGAAGG - Intronic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1083712951 11:64560000-64560022 CAGGAGGGGGAGCGGGAGGAGGG - Intronic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083894801 11:65614405-65614427 CAGGAGAGGCAGAGAGGGAAAGG + Intronic
1083997557 11:66279620-66279642 CAGGTGAGGCACCGGGAGGAAGG - Intronic
1084191412 11:67500612-67500634 CAGGAAAGGCAGTGGGCGGGGGG - Intronic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1084978944 11:72818383-72818405 AGGGACAGGAATAGGGAGGAGGG - Intronic
1085299518 11:75450078-75450100 CAGGAGAGGCCGATGGAGCAGGG + Intronic
1085383314 11:76140149-76140171 GAGGACTGGCAGAGGAGGGAGGG - Intronic
1085743048 11:79093288-79093310 CTGGACTGGCAGAGGGAGCTTGG + Intronic
1085754217 11:79190826-79190848 CGGGAGAGGGAGAGGGAGAAGGG - Intronic
1085814132 11:79717763-79717785 CAGGAGAGTGAGAGGGAGAAAGG + Intergenic
1086957961 11:92953504-92953526 CAGGAGTGGCAGAGGCAGAAAGG + Intergenic
1087019685 11:93589642-93589664 CAGGCCAGGGAGTGGGAGGTGGG + Intergenic
1087294678 11:96357126-96357148 AGGGACAGACAGAGTGAGGATGG + Intronic
1087483729 11:98734467-98734489 CTGGCCAGGCAGTGGGAGGGTGG - Intergenic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089111736 11:116062704-116062726 CAGCTCACGCAGAGGGAGGCAGG + Intergenic
1089270747 11:117300030-117300052 CAGGAGAGGAAGGGGGAGGCAGG - Intronic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089561344 11:119344809-119344831 CAGGACTGGGAGTGGGTGGAGGG + Intronic
1089612535 11:119677485-119677507 AAGGAGAGGAGGAGGGAGGAGGG + Intronic
1089626599 11:119754993-119755015 CAGGCCAGCATGAGGGAGGAGGG + Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1090116522 11:123979489-123979511 CAGCACTGGCAGAGGGTGGGAGG + Intergenic
1090208527 11:124899027-124899049 CAGGATGGGAAGGGGGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090357805 11:126151580-126151602 GACCACAGGTAGAGGGAGGAAGG + Intergenic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090878138 11:130809527-130809549 CAGGACAGTACCAGGGAGGAGGG - Intergenic
1090955934 11:131512851-131512873 CAAGACAGGGAGAGGGTGGGGGG - Intronic
1091042458 11:132294612-132294634 GAGGACAGGAGGAGGCAGGAAGG + Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091172657 11:133532185-133532207 CAGGAGAGGCAGTGGGGAGATGG - Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1202820491 11_KI270721v1_random:67198-67220 CTGGTCTGGCAGAGGGAGGGCGG + Intergenic
1091449217 12:562226-562248 CAGAACAGGCAGGGTGATGAAGG + Exonic
1091776335 12:3187363-3187385 AAAGGCAGGCAGAGGAAGGAAGG - Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1091990990 12:4955701-4955723 CCGGACTGGAAGAGAGAGGAGGG + Intergenic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092672826 12:10882780-10882802 CAGGTCAGGCAGAGAGGGGCCGG - Intronic
1093140618 12:15506583-15506605 CAGGACAGAGAGAGAGAGCAGGG + Intronic
1093141634 12:15516567-15516589 GAGGGCAGGGGGAGGGAGGAAGG + Intronic
1093728746 12:22544368-22544390 CCGGAGAGGCGGCGGGAGGAAGG + Exonic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1095859297 12:46897864-46897886 CAGGAGAGGGAGAGAGAGAAAGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096252379 12:50041363-50041385 CAGGCCTGACAGAGTGAGGAGGG + Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096652184 12:53067269-53067291 GAGGGCAGGCAGGGGGAGGTGGG + Intronic
1097285995 12:57877922-57877944 CATGAAAGGCAGAGAGAGAAGGG + Intergenic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097793211 12:63836965-63836987 AAAGACAGGCAGAGAGAGAAAGG - Intergenic
1098122549 12:67257061-67257083 CAGAAGAGGCAGAGGAAGGTTGG - Intergenic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099048599 12:77755498-77755520 AAGGAAAGGCACAGGGAGGGAGG - Intergenic
1099536733 12:83855023-83855045 CAAGATAGGCAGATGTAGGAAGG + Intergenic
1100379705 12:94049994-94050016 CAGGGCAGGAAGTGGGTGGAGGG + Intergenic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1102327385 12:111998816-111998838 CAGGAAAGGCAAAGGGGGAAAGG + Intronic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102812714 12:115838132-115838154 GTGGACAGGTAGAGGGCGGAAGG + Intergenic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103256218 12:119543672-119543694 CAAGACAGAGAAAGGGAGGAGGG + Intergenic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1103743322 12:123105970-123105992 CAGGACAGGCAGGGCCAGGAAGG - Intronic
1103898741 12:124292265-124292287 TAGGAAGGGCAGAGGGAAGAAGG - Intronic
1103936377 12:124479746-124479768 GATGCCAGGCAGAGGGAGGAGGG + Intronic
1104019873 12:124984980-124985002 GAGGAAAGGCCGAGGGAAGAGGG + Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104781462 12:131423075-131423097 CAGGTCAGGCAGTGGAGGGAGGG + Intergenic
1104814476 12:131637830-131637852 TGGGGCAGTCAGAGGGAGGAGGG + Intergenic
1104961115 12:132489263-132489285 CAGGACAGGCCGAGCTCGGAGGG - Intergenic
1104972620 12:132538891-132538913 CAGGACAGCGAGAGGAAGGTGGG + Intronic
1105954636 13:25268936-25268958 CAGAACAGGCAGTGGGAGTTGGG - Intronic
1106200746 13:27534902-27534924 GAGGACAGGCACAGAGAGGTTGG - Intergenic
1106373840 13:29164249-29164271 CTGGAAAGGCAGAGCGAGAAGGG - Intronic
1106404379 13:29461181-29461203 CAGGACAGAGAGAGAGAGAAGGG + Intronic
1106442063 13:29784226-29784248 CGGGAAAGAAAGAGGGAGGATGG + Intronic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107441390 13:40430395-40430417 CAGGAGAGGGAGAGGGATAATGG + Intergenic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107744813 13:43493150-43493172 CAGGAGAGGGAGTGGGAGGGGGG - Intronic
1107861958 13:44669624-44669646 GAGGACAGGCAGAGCAAGAAGGG + Intergenic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108182448 13:47854517-47854539 CAGGACAGCAAGAGTGTGGAAGG + Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111951777 13:94713501-94713523 CAGGACTCGGGGAGGGAGGAGGG + Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112446763 13:99471581-99471603 GAGGGAAGGAAGAGGGAGGAAGG + Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114506102 14:23215181-23215203 CAGGAGAGGCAGAGGGGTGGGGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115430315 14:33309898-33309920 CTGGCCCTGCAGAGGGAGGAGGG + Intronic
1116110561 14:40575330-40575352 CATGACATGCAGTGGCAGGACGG + Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1116868367 14:50049514-50049536 GAGGCCAGGAAGAGGGAGGCTGG - Intergenic
1117754899 14:58964737-58964759 GGCGACAAGCAGAGGGAGGAGGG - Intergenic
1117794640 14:59379714-59379736 CAGGAGAGTCAGAGGGAGAGAGG + Intergenic
1118116780 14:62786918-62786940 CAGGAGAGGAAGAGGGAGTTGGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119628859 14:76208590-76208612 CAGGACAGGCACTGGCAAGAAGG - Exonic
1119968915 14:78947724-78947746 CAGGGCAGGCTGAGGGACCATGG - Intronic
1120346239 14:83294059-83294081 GAGGAGAGGCAGGGAGAGGAGGG - Intergenic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1120781573 14:88490458-88490480 CAGGGCAGGAAGAGGTGGGAGGG - Intronic
1120911706 14:89672776-89672798 GAGGTCAGGCAGAGGGAGCCTGG - Intergenic
1121113873 14:91330437-91330459 CAGGACAGACAGAGGCAGACTGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121592362 14:95125677-95125699 GGGGACAGGGAGGGGGAGGAGGG + Intronic
1121845506 14:97169032-97169054 GAGGACAGGCAGCAGAAGGAGGG - Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122254883 14:100469246-100469268 CAGGAGACGCAGAGGGAAAATGG + Intronic
1122501309 14:102201985-102202007 AGAGACAGGCAGAGGCAGGAAGG - Intronic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122907773 14:104810105-104810127 CAGAACTGGCAGAGCCAGGATGG - Intergenic
1122951389 14:105047080-105047102 CATGCCAGGCAGAGTGGGGATGG + Intergenic
1123003165 14:105307445-105307467 CAGGACAGGGAGGGGGTGAAGGG - Exonic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1202936348 14_KI270725v1_random:91540-91562 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1124866682 15:33499193-33499215 GAGGAGAGGCAGGGAGAGGAAGG - Intronic
1124879511 15:33628299-33628321 CAAGAAAGGAAGAGGGAGGAGGG + Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125501630 15:40243281-40243303 CAGGGCGGGAAGAGGCAGGATGG + Intronic
1125719420 15:41838233-41838255 CATAACAGGCACAGGCAGGAAGG + Intronic
1125886663 15:43234644-43234666 CAGAAGAGGCAAAGGAAGGAGGG + Intronic
1126145012 15:45465903-45465925 CAAAACAGGCAGAAGAAGGAGGG + Intergenic
1126688057 15:51265481-51265503 GAAGACAGGCTGAGGGAGGCAGG + Intronic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1127857208 15:62962566-62962588 CTGGCCAGGCAGAGGGCAGAGGG - Intergenic
1128091510 15:64922123-64922145 AGGGACAGGCAGAGGCAGGTTGG - Intronic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129358975 15:75012593-75012615 CAGCACAGCCAGGGGAAGGATGG + Intronic
1129681462 15:77660722-77660744 GTGGACAGGCAGAGAGTGGAGGG + Intronic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1129771559 15:78206364-78206386 AGGGACAGGCTGAGGAAGGAGGG - Intronic
1129839477 15:78734882-78734904 CAGAAGAGGCTGGGGGAGGAGGG + Intergenic
1129905276 15:79182877-79182899 AAAGAAAGGAAGAGGGAGGAAGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130661355 15:85833719-85833741 CAGAACAGGAAGGGGAAGGAGGG + Intergenic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1130894044 15:88157073-88157095 CAGGACAGGTGGGTGGAGGAGGG - Intronic
1130999977 15:88932193-88932215 CAGGACAGTGAGAGGGATCATGG + Intergenic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131165846 15:90141775-90141797 CAGGAGCGGCAGGGGGATGAAGG + Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131536179 15:93239874-93239896 CAGTCCAGGCAGGGGGAGGCAGG - Intergenic
1131671270 15:94621955-94621977 GAGGCAAGGCAGAGAGAGGAGGG + Intergenic
1131983759 15:98020722-98020744 CAGGACAGGGACAGGGATGGAGG - Intergenic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132359480 15:101200882-101200904 GAGACCTGGCAGAGGGAGGAGGG - Intronic
1132376788 15:101333458-101333480 CAGGAAAGGAAGAGGAAGCAGGG - Intronic
1132679404 16:1133565-1133587 GAGGACAGACAGAGGGAAGCTGG - Intergenic
1132690595 16:1180363-1180385 CAGGGCAGGCTGGGTGAGGAGGG + Intronic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1132758803 16:1499076-1499098 CAGCTCAGGCAGTCGGAGGATGG + Intronic
1132825316 16:1902124-1902146 CATGACAAGCTGAGAGAGGAAGG + Intergenic
1132832987 16:1938576-1938598 CAGGCCAGCCAGAGTGGGGATGG - Exonic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133040637 16:3058432-3058454 CAGGACCGGCAGCTGGAGGGCGG + Exonic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1134215132 16:12311428-12311450 CAGGAAAGGAGGACGGAGGAGGG - Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134567886 16:15266708-15266730 AAGGATTGGCAGAGGGAGGGCGG - Intergenic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134734549 16:16489645-16489667 AAGGATTGGCAGAGGGAGGGCGG + Intergenic
1134823671 16:17267099-17267121 CAGCACAGGGTGAGGCAGGAAGG + Intronic
1134851183 16:17480295-17480317 GAGGAAAGTCAGAGGCAGGAGGG - Intergenic
1134932917 16:18222261-18222283 AAGGATTGGCAGAGGGAGGGCGG - Intergenic
1135156154 16:20054703-20054725 AAAGAAAGGAAGAGGGAGGAAGG - Intronic
1135157876 16:20069773-20069795 GAAGACAGTGAGAGGGAGGATGG - Intronic
1135589495 16:23694982-23695004 AAGGACAGGGAGCGGGAGGCAGG + Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135739102 16:24958007-24958029 AAGGACAGGCAGAGGTGGGAGGG + Intronic
1135754325 16:25083799-25083821 CAGGAGAGGAAGAGGGGGGAAGG - Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136283872 16:29230190-29230212 CAGGCCAGGTGCAGGGAGGACGG + Intergenic
1136537748 16:30910405-30910427 CAGGACAGGGAGCGGGTGGGAGG + Intergenic
1136544081 16:30946160-30946182 CAAGACAGCAAGAGAGAGGAGGG + Intronic
1136594681 16:31239847-31239869 CCAGACAGGGAGAGAGAGGAGGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137552063 16:49444376-49444398 CAGGACAGGAAAAGAGAGAAAGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138351878 16:56350374-56350396 CTGCACAGGGAGTGGGAGGAAGG - Intronic
1138490299 16:57372609-57372631 CAGGACAGTCAGATGGCAGAAGG - Exonic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1138628944 16:58278217-58278239 AAGGAGAGGAAGAGGAAGGAGGG + Intronic
1138659856 16:58510511-58510533 AAGGACAGGCACAGAGAGGCTGG - Intronic
1139240746 16:65389445-65389467 CAGGACAGAAAGAGGAAAGAAGG - Intergenic
1139476045 16:67203044-67203066 GAGGGCAGGCAGAGGGCGGCTGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139558131 16:67725552-67725574 CAAGGCAGGCAGTGGGAGGTGGG + Exonic
1139657583 16:68398148-68398170 GAGAACAGGCAGAGGGAAAAAGG + Intronic
1140153783 16:72401174-72401196 GAGGAGAGGGAGAGGGAGGGGGG + Intergenic
1140230201 16:73111729-73111751 AAGGACAGAGGGAGGGAGGAAGG + Intergenic
1141080544 16:81047898-81047920 CAGGACGGCCAGAGAGAGAAGGG + Intergenic
1141626034 16:85261562-85261584 CAGGACAGGCTCAGAGTGGAGGG + Intergenic
1141704645 16:85658181-85658203 CAGGGCAGGCAGGGGCAGGGAGG - Intronic
1141705432 16:85661950-85661972 CAGGACAGGCACGGGGACTAGGG - Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141773024 16:86102331-86102353 AAGGAGAGGGAGAGGAAGGAAGG - Intergenic
1141868357 16:86766719-86766741 CAGGACTGCTAGAGAGAGGAGGG - Intergenic
1141891772 16:86930920-86930942 GAGGAAAGGGAGGGGGAGGAGGG - Intergenic
1142008200 16:87700451-87700473 CAGATAAGGCGGAGGGAGGAGGG + Intronic
1142192615 16:88724936-88724958 CAGGCCAGGCAGAGGACAGATGG + Intronic
1142200874 16:88760611-88760633 CAGGACAGGCAGGGGCCCGAGGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142445178 16:90131729-90131751 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1142462331 17:103737-103759 GAGGAGAGGCAGGGGTAGGAGGG + Intergenic
1142597653 17:1037331-1037353 GAGGTCAGGCAGAGGGAGGCTGG - Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142604477 17:1073951-1073973 CAGGACAGGCCTGGGGAGGGGGG - Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142683980 17:1566682-1566704 GAGGACGGACAGAGGGAGCAAGG - Intergenic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143526567 17:7476542-7476564 CAGCACAGGCAAAGGCATGAAGG - Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1143964664 17:10748623-10748645 CTATACAGGCAGAGGCAGGAAGG - Intergenic
1143998346 17:11028973-11028995 CAAGAAAGCCAGTGGGAGGATGG + Intergenic
1144145199 17:12390743-12390765 CAGAACAGGAAGAGGAAGGTTGG + Intergenic
1144457622 17:15432075-15432097 CTGGACCAGCAGAGGTAGGATGG - Intergenic
1144668564 17:17118482-17118504 GAGGACAGGCATTGGGATGAGGG + Intronic
1145242699 17:21249014-21249036 CAGGAGGGGCAGAGAGAGCATGG - Intronic
1145733443 17:27211294-27211316 CGGGAGAGGCAGAGGGAGACGGG - Intergenic
1145756030 17:27390601-27390623 CAGGAAAGGCCAAGGCAGGATGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146176085 17:30667479-30667501 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146349543 17:32083589-32083611 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147317275 17:39626976-39626998 GAGGAGAGGCTGAGGGAGGGAGG + Exonic
1147319915 17:39639883-39639905 CAGAAAAGCCACAGGGAGGAGGG - Intronic
1147363196 17:39944199-39944221 CAGGACAGGCAGGTGCTGGAAGG - Exonic
1147428396 17:40357029-40357051 GTGGTCAGGCAGAGGGAGAAAGG - Intronic
1147573115 17:41583497-41583519 CAGGACTGGCAGGGAGAGAACGG - Intronic
1147575130 17:41594597-41594619 GAGGACAGAGGGAGGGAGGAGGG + Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147627616 17:41910110-41910132 GAGGACAGTCAGAGGGACCAGGG - Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147961159 17:44168438-44168460 CAGGACAGGCAGCGGGAGAAGGG + Intergenic
1148109567 17:45136953-45136975 CAGGGCAGGAGCAGGGAGGAAGG + Intronic
1148177503 17:45580018-45580040 AAGGACAGGCAGATTGAGGGAGG - Intergenic
1148551235 17:48551832-48551854 GAGGGCAGCTAGAGGGAGGAGGG + Intronic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148743972 17:49908249-49908271 CAGGACAGGGAGACAGAGCAGGG + Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149010427 17:51850975-51850997 CAGGGCAGGCACTGGGAAGAAGG - Intronic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1149543213 17:57484161-57484183 AAGAACAGTCACAGGGAGGAAGG - Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151163026 17:72181813-72181835 CAGGAAAGGCAAAGGGCAGAAGG - Intergenic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1151315852 17:73322111-73322133 CAGGACACGCATGTGGAGGAGGG - Intergenic
1151385113 17:73750437-73750459 CAGCACAAACAGAGGGAGGTGGG + Intergenic
1151472729 17:74327921-74327943 GAGGACAGGCAGATGGGGGTGGG + Intronic
1151678700 17:75613170-75613192 TAGGACAGGCAGTGGGGGAAAGG - Intergenic
1151719238 17:75846195-75846217 CAGGACAGGGAAGGGAAGGAAGG + Exonic
1152022965 17:77790722-77790744 CAGGCCAGCCAGAGCAAGGAGGG + Intergenic
1152023555 17:77794653-77794675 GGAGACAGGCAGAGGGAGCAAGG + Intergenic
1152037275 17:77881123-77881145 CAGGATAGGAGGATGGAGGATGG + Intergenic
1152243032 17:79170101-79170123 CAGGAAAGGAGGAGGAAGGAAGG + Intronic
1152251669 17:79215768-79215790 CAGGGCAGGCTGAGAGAGGGCGG - Intronic
1152297513 17:79476722-79476744 GAGGATAGGCAGAGGCAGGGTGG + Intronic
1152350708 17:79782456-79782478 CAGGACAGGATGGGGGAGGAGGG + Intronic
1152354287 17:79799218-79799240 CGGGACAGGCAGAGGGACCCGGG - Intronic
1152400767 17:80065052-80065074 GAGGAGGGGGAGAGGGAGGAGGG - Intronic
1152428243 17:80230572-80230594 CAGGCCAGGCTGGTGGAGGAAGG + Intronic
1152713168 17:81885041-81885063 CAGGACAGCCAGAGGCAGAGGGG + Intergenic
1152772555 17:82179241-82179263 CAGGAAAAGCAGAGGCACGATGG + Intronic
1152812998 17:82391051-82391073 CCAGACAGGCTAAGGGAGGAGGG + Intronic
1152841201 17:82569673-82569695 CAGCACAGGCACAGTGACGAAGG + Intronic
1153003250 18:475232-475254 CAGGACTGACACTGGGAGGAAGG - Intronic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153814282 18:8779475-8779497 CAGCTCAGGCAGCGGGAGGCTGG - Intronic
1153906821 18:9669176-9669198 CAAGAAGGGCAGAGGAAGGAAGG - Intergenic
1153917726 18:9760636-9760658 CCCGACAGACAGAGGGAGAAGGG - Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154332833 18:13443676-13443698 GACGACAGGAAGAGGGAGGGAGG - Intronic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1155437206 18:25826087-25826109 AATGACAGGCAGTGGGTGGAGGG - Intergenic
1155546772 18:26923979-26924001 GATGACAGGGAGAGGCAGGAGGG + Intronic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1156197423 18:34790954-34790976 GAGAATAGGCAGCGGGAGGATGG + Intronic
1156270229 18:35523871-35523893 CAGAACAGGAAGAGCAAGGATGG - Intergenic
1156928697 18:42615113-42615135 CAGGAAAGGCTTAGGGAGAAAGG - Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157180663 18:45495194-45495216 AAAGACAGACAGAGGAAGGAGGG + Intronic
1157211954 18:45750574-45750596 CAGGACTGCAAGAGGGAGAAAGG + Intronic
1157323951 18:46655948-46655970 GAGGACAGGAAGAGGGAGAAAGG + Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157729242 18:49989468-49989490 CAGGACAGGGACAGGAAGCATGG + Intronic
1157746277 18:50138840-50138862 CAGCCCAGGCTGAGGCAGGATGG - Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158500406 18:57995748-57995770 AAGGACAGGAGGAGGGAGGGAGG + Intergenic
1158875266 18:61728141-61728163 CAGGGCGGGAGGAGGGAGGAGGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1159535367 18:69707984-69708006 CAGCACAGGCAGAGCACGGATGG + Intronic
1160544970 18:79647215-79647237 AAGGAAAGGGGGAGGGAGGAAGG + Intergenic
1160689497 19:454877-454899 CAGCACTGGGAGAGGCAGGACGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160969683 19:1762076-1762098 CAAGACTGCCAGAGGGCGGATGG - Intronic
1160979934 19:1812191-1812213 CAGGAGAGGCAGGGGGGGGCAGG + Exonic
1161239356 19:3213406-3213428 AAGGAAGGGGAGAGGGAGGAGGG + Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1161667483 19:5586037-5586059 CAGAACCGGCAGTTGGAGGAGGG + Intergenic
1161772475 19:6238642-6238664 CAGGACAGGGGCAGGGTGGAAGG - Intronic
1161790667 19:6357984-6358006 CAGGGCAGGCAGGGGGTGCAGGG + Intergenic
1161973703 19:7597156-7597178 AAGGCCAGGGAGAGGGGGGATGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1162352608 19:10159801-10159823 AGGGACAGGCAGAGGAAGGCTGG + Intronic
1162548529 19:11345609-11345631 CAGGACTGCAAGATGGAGGAAGG - Exonic
1162758103 19:12872482-12872504 CAGGACCTGAAGTGGGAGGAGGG + Intronic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1162926449 19:13932736-13932758 CAGGGCAGGCAGGGGGATGGAGG + Exonic
1163030543 19:14541319-14541341 CAGGACAGCCACGGGCAGGATGG - Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163681249 19:18683856-18683878 CAGGGCCGGCGGAGGGAGGGAGG + Intronic
1164628727 19:29746968-29746990 CAAGACAGGCAGAGTGAGAGTGG - Intergenic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1165058116 19:33191719-33191741 CAGGACATGCAGAGAGGAGACGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165773084 19:38389499-38389521 CGGGAAGGGAAGAGGGAGGAAGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166453744 19:42922909-42922931 CAGGTGAGGCAGAGAGAGGGAGG + Intronic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167104466 19:47421992-47422014 TGGGCCAGGCAGCGGGAGGACGG - Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167497575 19:49828575-49828597 CAGGCCAGGCAGAGAGAGACCGG - Intronic
1167552389 19:50170022-50170044 AGGGACAGACAGAGGGAGGGAGG - Intergenic
1167600377 19:50451387-50451409 GAGGATAGGCAGGGCGAGGAAGG + Intronic
1167699407 19:51033737-51033759 CAGGAATGGGAGAGGCAGGAGGG + Intronic
1167723124 19:51192525-51192547 CAAGACACACATAGGGAGGAAGG + Intergenic
1167761084 19:51449737-51449759 CAAGACACACATAGGGAGGAAGG - Intergenic
1168173582 19:54607413-54607435 CAGGACAGGCAGACAGTGAAAGG + Intronic
1168667473 19:58215259-58215281 CAAGACAGGAAGAGGAAGGCAGG + Intergenic
1202684201 1_KI270712v1_random:33952-33974 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925118370 2:1398863-1398885 CAGGACTGACAGAGGGTGGGGGG + Intronic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
925631085 2:5894358-5894380 AAGGACAGGCAGAGAGGGAAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925957049 2:8977034-8977056 GAGGCCAGGGAGAGGCAGGAGGG + Intronic
926057045 2:9779899-9779921 CATCACAGGCAGAGGCAGGCTGG - Intergenic
926266852 2:11330921-11330943 GAGGAGAGGAGGAGGGAGGAAGG + Intronic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927430321 2:23021763-23021785 CAGCTCTGGCAGAGGCAGGACGG + Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
927850819 2:26498234-26498256 CAGTAGAGGCGGAGGGTGGAGGG + Intronic
927882354 2:26697668-26697690 CAGGACCTGCAGTGGGAGAATGG - Intronic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928181274 2:29070692-29070714 GAGGAAAGGCAGAGGGTTGAGGG + Exonic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928497754 2:31851709-31851731 CGGGGCCGGCGGAGGGAGGAAGG - Intergenic
928924673 2:36565573-36565595 GAGGTCAGGTAGAAGGAGGAGGG - Intronic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929483916 2:42338285-42338307 AAGGAAAGGCAGAGGCTGGATGG - Intronic
929593841 2:43163335-43163357 CAGGAGAGGCAGAGAAGGGAGGG - Intergenic
930664724 2:54090662-54090684 CAGGATTGGCAAAGGCAGGAAGG - Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931064689 2:58572104-58572126 CAGGAGGGGCAAAGGGAAGATGG - Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931526827 2:63165805-63165827 AAGAAATGGCAGAGGGAGGAAGG - Intronic
932312824 2:70757680-70757702 CAGGACAGGAAAAGTGAGGGCGG - Intronic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933299239 2:80523947-80523969 TAGGATAGGCAGAGGTAGAAGGG + Intronic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933767220 2:85718527-85718549 CAGGACAGGCAGCTGGGAGAGGG - Intergenic
933897374 2:86824098-86824120 CAGGCCAGGCAGGGAGAAGAGGG - Intronic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
934247518 2:90320900-90320922 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
934261806 2:91481701-91481723 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934654250 2:96108991-96109013 CAGGATAGGGGAAGGGAGGAAGG + Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935638144 2:105266291-105266313 CAGGACCGACAGCGGGTGGAAGG - Exonic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
935659718 2:105455805-105455827 CAGGAGAGGCAAAGGCTGGAGGG - Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936530265 2:113271421-113271443 TTGGAAAGGCAGAGGGAGGGAGG - Intronic
936659794 2:114529832-114529854 GAGGACAGAGGGAGGGAGGAGGG - Intronic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
937086443 2:119174894-119174916 CTAGAACGGCAGAGGGAGGAGGG + Intergenic
937729771 2:125214597-125214619 CATGACAAGCAGAGCCAGGAAGG - Intergenic
938070108 2:128303942-128303964 CAGAACAGGAAGGTGGAGGAAGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938657092 2:133445708-133445730 CAGCACAGGGAGAGTAAGGAAGG + Intronic
938722464 2:134078837-134078859 CAGGACAGGCTGAGGGGTGAAGG - Intergenic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
939225159 2:139354832-139354854 GAGGGCAGGCAGAGAGTGGAGGG + Intergenic
939961465 2:148569373-148569395 GAGGCCAGGCTGAGGGTGGAGGG + Intergenic
939996860 2:148927889-148927911 AGGGACAGGGAGAGAGAGGAGGG - Intronic
940007938 2:149026166-149026188 TGGGAAAGGCAGAGGGTGGAGGG + Exonic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940636775 2:156307337-156307359 GAGGAGAGGGAGAGGGAGAAGGG + Intergenic
940742955 2:157532821-157532843 CAGAAAAGGAAGAGGAAGGAAGG - Exonic
940809994 2:158231583-158231605 GAGGAGAGGGAGAGGGAGAAAGG - Intronic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941001711 2:160209121-160209143 CCAGACAGGCAAAGGGAAGAGGG + Intronic
941036657 2:160576094-160576116 CAGCACAGGCAGAGGCAAGCTGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
942386233 2:175446364-175446386 CAGGACAGCCAGGGGAAGGAGGG - Intergenic
942602801 2:177658454-177658476 GAGGAGAGGCAGAGGAGGGAAGG - Intronic
943280330 2:185924073-185924095 CAGAACAGGGAGAGAGAGTATGG - Intergenic
943935453 2:193909647-193909669 GAGGACAGGGAGAGAGATGAAGG - Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944159073 2:196639860-196639882 CAGGACAGGGAGAGGGCGCCAGG - Intronic
944260283 2:197668791-197668813 CAGGACTGTCCCAGGGAGGAAGG - Intronic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946154159 2:217796284-217796306 CAGGAGGGGCAGAGGGATGGCGG - Intergenic
946484131 2:220084692-220084714 CAGGACAGGCACATAGAGAAAGG - Intergenic
946582446 2:221144238-221144260 CAGGACAGGCCGGGGCATGATGG - Intergenic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
947156283 2:227164957-227164979 CGGGACAGGCAGCGAGCGGAAGG + Intronic
947377733 2:229513884-229513906 GAGGACAGGGAGAGGGAGGGAGG - Intronic
947483072 2:230521141-230521163 CATGACAAGCAGAGAAAGGATGG - Intronic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947650543 2:231782493-231782515 GGGGACAGGCAGAGGAAGGAAGG - Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947810261 2:232999686-232999708 CACCCCAGCCAGAGGGAGGAGGG + Intronic
947864502 2:233386890-233386912 CAGGAAGGGCACAGTGAGGATGG + Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
947952733 2:234161942-234161964 GAGCACAGGCTGAGGGAGGAGGG - Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948612051 2:239176187-239176209 AAGGCCGGGCAGAGGGAGGGAGG - Intronic
948612080 2:239176271-239176293 GAGGCCGGGCAGAGGGAGGGAGG - Intronic
948612088 2:239176290-239176312 AAGGCCGGGCAGAGGGAGGGAGG - Intronic
948612117 2:239176374-239176396 AAGGCCAGGCAGAGGGAGGGAGG - Intronic
948703073 2:239772851-239772873 GAGGAAAGGAGGAGGGAGGATGG - Intronic
948776269 2:240290459-240290481 AAGCACAGGCAGGGGAAGGAAGG + Intergenic
948789197 2:240368686-240368708 CAAGACAGGCAGAGCCTGGAGGG + Intergenic
948949091 2:241237206-241237228 CAGGAGAGGCAGTGGGAAGGGGG + Intronic
1168749337 20:271075-271097 GAGGAAGGGCAGAGGGAGCAGGG + Exonic
1168751308 20:283908-283930 CAGGACAGGGACGGGGATGATGG - Intronic
1168845303 20:940390-940412 CAGCAAAGGCAGAGGGTGGGAGG + Intergenic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1169495755 20:6113369-6113391 AAGGAAAGGGAGAGGGAGCAAGG - Intronic
1169912016 20:10654755-10654777 CTGGGCAGGGAGAGGGAGGTGGG + Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171027427 20:21643711-21643733 CAGCACAGGAAGGGGGAAGAAGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171238735 20:23548306-23548328 CAGGACAGGACCAGGGAGGGAGG + Intergenic
1171240687 20:23565138-23565160 CAGGTCAAGCAGTGGGAAGACGG + Intronic
1171242869 20:23585932-23585954 CAGGGCAGGACGAGGGAGGGAGG - Intergenic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171410371 20:24943089-24943111 CAGGACAGGCAGAGCAATGGGGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172344839 20:34189944-34189966 TAGGACATGCAGAGGCAGGCAGG + Intergenic
1172514125 20:35521423-35521445 CATTCCAGGCAGAGGGAGCAAGG + Intergenic
1172782932 20:37447854-37447876 GAGCACAGGGAGAGGGAAGATGG - Intergenic
1172830460 20:37829691-37829713 AAGGACAGGTACAGGGAAGAGGG - Intronic
1172867590 20:38112109-38112131 AAAGAAAGGCAGAGGAAGGAAGG - Intronic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1173174861 20:40756806-40756828 GGGGACAGGCAAATGGAGGAAGG - Intergenic
1173199496 20:40944162-40944184 CAGGAGAGGCGGAGGGAGGGAGG - Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173427386 20:42954924-42954946 GAGGAGAGGAAGAGGGAGAAGGG + Intronic
1173452838 20:43180388-43180410 TATGACAGGGAGAGAGAGGAAGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173615422 20:44400328-44400350 CGAAACAGGGAGAGGGAGGAGGG + Intronic
1173616127 20:44403956-44403978 GAGGAGAGGCCGAGGGAGAAAGG + Intronic
1173776181 20:45708316-45708338 CAGGACAGGCACAGTGGGGGTGG + Exonic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174102499 20:48138276-48138298 CAGGACAGAGAGCGGGAGGGAGG - Intergenic
1174215285 20:48911776-48911798 GAGGTCAGGGAGAGGGAGGCAGG - Intergenic
1174420025 20:50393496-50393518 CAGGACAGGCAGTGTATGGAGGG - Intergenic
1174554003 20:51381157-51381179 GAGGACAGGCAGAAGGGGAAAGG + Intergenic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1175213562 20:57377243-57377265 AAGGACTGGAAGAGGGAGGTGGG - Intronic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175916189 20:62427114-62427136 CGGGACAGGCCCAGGGTGGAGGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176074005 20:63240293-63240315 CAGAACAGGCAGAGAGGGGCAGG - Exonic
1176079970 20:63267604-63267626 CAGGACCTCCAGAGGGAGCACGG - Intronic
1176099902 20:63360212-63360234 CCAGGCAGGAAGAGGGAGGAAGG + Intronic
1176204684 20:63881920-63881942 CAGGACAGGCAAAGGGCAGCAGG - Intronic
1176266780 20:64213481-64213503 CAGGACAGGCATGGAGGGGAAGG + Intronic
1176587149 21:8598059-8598081 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1177232531 21:18341167-18341189 CCGGAGAGGCTGAGGCAGGAGGG - Intronic
1177412446 21:20747719-20747741 CAGTAAAGTCAGAGTGAGGAAGG - Intergenic
1177493360 21:21856918-21856940 GAGGACAGAGAGTGGGAGGAAGG + Intergenic
1178300114 21:31445791-31445813 GAGTACAGCCAGGGGGAGGAGGG + Intronic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178818279 21:35951523-35951545 CAGCACAGACATAGGGTGGAAGG - Intronic
1179146741 21:38774755-38774777 TGGTACAGGCAGGGGGAGGATGG + Intergenic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179337922 21:40475113-40475135 CACGACAGTCTGAAGGAGGAGGG - Intronic
1179439477 21:41382971-41382993 CAGGAGAGGCACAGGGGTGAGGG + Intronic
1179446750 21:41437226-41437248 CAGCACAGGCCCAGGGAGGTGGG - Intronic
1179451573 21:41472066-41472088 CAAGACACCCAGAGGCAGGATGG + Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179726991 21:43346369-43346391 CAGGACAGGCTCGGGGTGGAGGG - Intergenic
1179798021 21:43796987-43797009 CAGCACAGGCAGAGAAAGGAAGG - Intronic
1180048060 21:45318749-45318771 CAGGGCAGGAAGGGGCAGGATGG - Intergenic
1180116181 21:45706698-45706720 CTAGCCAGGCAGAGGGAGGCAGG + Intronic
1180174721 21:46082043-46082065 CAGGTCAGGCAGAGGATGAATGG + Intergenic
1180206008 21:46261052-46261074 CAGGAAAGGCAGGGGAAGGGAGG - Intronic
1180269980 22:10575056-10575078 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1180587927 22:16909807-16909829 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1180657554 22:17435968-17435990 CGAGACAGACAGAGGGAGGGAGG - Intronic
1180726154 22:17948170-17948192 CAGGGCAGGCAGTGGGAGTGGGG - Intronic
1180898264 22:19353114-19353136 CAGGACAGGCAGCAGGACGGAGG - Intronic
1181079399 22:20403912-20403934 CAAGACACGCAGAGGCAGGAAGG - Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181638830 22:24186498-24186520 CAGGACTGGGAGAGGCATGAAGG - Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182089083 22:27581791-27581813 CAGAAGAGGCAGAGGGAGCGCGG + Intergenic
1182094274 22:27615486-27615508 CAGGACCGGCTGAGCGGGGAGGG - Intergenic
1182292255 22:29289475-29289497 AAGGGCAGGCAGAGGCAGCAGGG - Intronic
1182482010 22:30615230-30615252 CAGGACAGGCAGGGGCTTGAGGG - Intronic
1182810564 22:33112631-33112653 AAGGACAGAGAGAGGTAGGAAGG + Intergenic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183097545 22:35562212-35562234 AGGGAAAGGCAGAGGGGGGAGGG + Intergenic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183967240 22:41449119-41449141 CCGGACAGGTTGAGGGAGGGCGG + Intergenic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184092329 22:42299235-42299257 GAGGACAATCACAGGGAGGACGG + Intronic
1184095747 22:42315357-42315379 GAGGACAGGCTCAGAGAGGAAGG + Intronic
1184106736 22:42371745-42371767 CCAGGCAGGAAGAGGGAGGAGGG - Intergenic
1184469870 22:44690345-44690367 CAAGGCAGGGGGAGGGAGGAGGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184794866 22:46726316-46726338 GAGGACCGGCAGAGGGAACAGGG + Intronic
1184992537 22:48180487-48180509 CATGGCAGCCCGAGGGAGGAGGG - Intergenic
1185039167 22:48495646-48495668 CAGCCCAGACAGAGAGAGGACGG - Intronic
1185093471 22:48790945-48790967 CAAGCCATGCAGAGAGAGGAAGG - Intronic
1185158132 22:49206512-49206534 CGAGGCAGGCAGAGGGAGGGTGG - Intergenic
1185190443 22:49433040-49433062 CCGGGCAGGGAGAGGGCGGATGG - Intronic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185191680 22:49441129-49441151 CCGGACAGGACGTGGGAGGAAGG - Intronic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
1185333710 22:50262416-50262438 CAGGACAGGCAGGGGTGGGATGG - Intergenic
949401096 3:3665940-3665962 AAGGACAGGGGGAGGGAGGGAGG + Intergenic
949512081 3:4775191-4775213 GAGCAAAGGCAGAGGGAAGAGGG - Intronic
949612594 3:5717994-5718016 CTACACAGGCAAAGGGAGGAGGG + Intergenic
950108304 3:10402293-10402315 AAGGAGAGGCAGAGGCAGGTTGG - Exonic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950447473 3:13046650-13046672 CGGGCCATGGAGAGGGAGGAGGG - Intronic
950790892 3:15470915-15470937 CAGAACAGGCAGTGAGAGGCTGG + Intronic
950872542 3:16242191-16242213 CAGCCCAGGCTCAGGGAGGAGGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
953337615 3:42107095-42107117 CAGGACAGGGGGAGGGATGTGGG + Intronic
953431493 3:42844250-42844272 GAGGTGAGGCAGAGGAAGGAAGG + Intronic
953855655 3:46497592-46497614 GAGGAGAGGCACAGGGAAGAAGG - Exonic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
954429705 3:50463999-50464021 CAGATCATGCAGAGGGAGCATGG + Intronic
954450939 3:50571353-50571375 GAGGACAGGAAGAGGGAGGAGGG + Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954645743 3:52130586-52130608 GAGGACATGCAGAGAGAGAACGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955294870 3:57725828-57725850 CAGGTCAGGATGAGGGAGCAGGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
955830485 3:62996390-62996412 ACGGACAGACAGAGGGAGGGAGG + Intergenic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956176302 3:66476358-66476380 GAGGAGAGGCTAAGGGAGGAAGG - Intronic
956324854 3:68040690-68040712 TAGGTCTGGCAGAAGGAGGAAGG - Intronic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956955875 3:74339193-74339215 CTGGACAGCTGGAGGGAGGAGGG - Intronic
956972051 3:74537640-74537662 TAGGGAAGGCAGAGGAAGGATGG + Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
959500425 3:107100343-107100365 CAGCACAGTGTGAGGGAGGAGGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960179847 3:114562786-114562808 CAGGAGAGGGAGAGAGATGAAGG + Intronic
960883226 3:122367106-122367128 GGAGACAGGGAGAGGGAGGAAGG + Intronic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961460290 3:127045673-127045695 GAGGAGAGGGAGAGGGAGGGAGG + Intergenic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
961768262 3:129229018-129229040 CACCCCAGGCAGAGGGAGAAAGG - Intergenic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962784771 3:138757643-138757665 GAGGAGAGGGAGAGGAAGGAGGG + Intronic
962812432 3:138971230-138971252 GAGAACAGCCTGAGGGAGGAAGG - Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963960703 3:151305730-151305752 GAGGACAGGAAGTGGGAGGGGGG + Intronic
964026045 3:152076274-152076296 CAAGGCAGGCATAGGGAGAATGG + Intergenic
964274413 3:154993910-154993932 GAGGACAGGTAGAGGAAGGAAGG + Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
964408046 3:156370510-156370532 CAGGACACTAAGAGGGATGAGGG + Intronic
964676811 3:159292214-159292236 GAAGACAGGTAGAGAGAGGAGGG + Intronic
964820374 3:160762324-160762346 AAGCACAGGCATAGGAAGGAGGG - Intronic
965009756 3:163073108-163073130 CAGAACAGGCACTGGGAGCAGGG - Intergenic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966442123 3:179957344-179957366 CAGGTAAGGCTCAGGGAGGAAGG + Intronic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966580274 3:181553755-181553777 AAGGAAAGGCAGAGAGAGAAGGG + Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966847980 3:184145184-184145206 CAGGCCCGGCAGTTGGAGGAAGG + Exonic
966928156 3:184658887-184658909 AAGGCCTGGGAGAGGGAGGAGGG - Intronic
967068057 3:185938091-185938113 GAGGAAAGGCAGAGCGAGGAGGG - Exonic
967189809 3:186975552-186975574 GTGGACAGGCAGAGGGAGACTGG - Intronic
967264444 3:187677970-187677992 GATGACAGGGAGAGGGAAGAAGG - Intergenic
968365794 3:198183859-198183881 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
968564546 4:1304089-1304111 CACGACTGACAGGGGGAGGAGGG - Intronic
968601481 4:1512007-1512029 CAGAGCGGGCATAGGGAGGAAGG + Intergenic
968610683 4:1555592-1555614 AAGGACAGGGACAGGGAGGCCGG - Intergenic
968617476 4:1584785-1584807 GAGGACAGGCAGAGGCTGCATGG + Intergenic
968628590 4:1638803-1638825 AAGGACAGGCAGGAGGAGGGGGG - Intronic
968717102 4:2168334-2168356 CAGGAAGGGGAAAGGGAGGATGG + Intronic
968785919 4:2622375-2622397 CAGGACAGGCATAAGGAAGCAGG - Intronic
968813341 4:2809784-2809806 CAGGGCAGGCAGAGGGCCAAGGG - Intronic
968952546 4:3702416-3702438 CAGTCCGGGCAGTGGGAGGAGGG - Intergenic
969117569 4:4881209-4881231 CAGGACAACCAGTGGTAGGAGGG - Intergenic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969351398 4:6600026-6600048 CAGCCCAGGCAGAGGCAGGGAGG + Intronic
969397176 4:6929604-6929626 CAGGAGGGGCAGGGGTAGGAGGG + Intronic
969455425 4:7297327-7297349 GAGGACAGGCAGAGGCAGAAGGG - Intronic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969489485 4:7490994-7491016 CAGGGCAGGGACAGAGAGGAGGG - Intronic
969493264 4:7511925-7511947 CAGGACCTGCAAAGGGAGAAAGG - Intronic
969501176 4:7554175-7554197 GAGGACAGGACCAGGGAGGACGG + Intronic
969641995 4:8404389-8404411 CAGGACAGGTGGAGTTAGGAGGG + Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970119954 4:12742465-12742487 CATGCCAGGAAGAGGGAGTAAGG - Intergenic
970640078 4:18054271-18054293 CAAGGCAGCCAGTGGGAGGAAGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971296711 4:25400355-25400377 GAGGAAAGGCTGAGAGAGGAGGG + Intronic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
972873317 4:43327548-43327570 GAGGAAAGGCAGAGAGAGCAAGG - Intergenic
972886159 4:43491352-43491374 GAGGCCAGGCCGAGGCAGGATGG + Intergenic
973242409 4:47970735-47970757 GAAGAAAGGCAGAGGGAGGGAGG - Intronic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
973980411 4:56304077-56304099 GAGAAGAGGCAGAGGGAGGGAGG - Intronic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977335003 4:95686779-95686801 CAAGACAGCCCTAGGGAGGATGG - Intergenic
977523191 4:98111595-98111617 CAGGCCAGGCAGATGTAGAAGGG - Intronic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
977830945 4:101592054-101592076 CAGGACAGGCAACAGGGGGAAGG - Intronic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978217433 4:106221803-106221825 CAGGACCGCTTGAGGGAGGAAGG + Intronic
978410628 4:108420944-108420966 CAGGAATGGTAGAGGAAGGAGGG + Intergenic
979254829 4:118599013-118599035 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
979334132 4:119447005-119447027 GAGGAGAGGCAGGGGAAGGAGGG + Intergenic
979495139 4:121374972-121374994 CGGCACAGCCAGAGGGAGGATGG - Intronic
979946830 4:126843292-126843314 CAGCACTGGAAGAGGGAGGGAGG - Intergenic
981037182 4:140184121-140184143 CAAGAAAGGCACAGGGATGAAGG - Intergenic
981570798 4:146148616-146148638 TGGGGCAGGCAGAGGGAGGGAGG + Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
984888975 4:184474634-184474656 GAGGAAGGGCGGAGGGAGGAGGG - Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985489516 5:171211-171233 CAGGACAAGCAGCGGGAGCTAGG + Exonic
985767443 5:1787441-1787463 CAGGACAGGGATATGGAAGATGG - Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
985835675 5:2270229-2270251 GAGGGCAGGCAGAGGCAGGGTGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986146089 5:5079190-5079212 CAGGACAGGCTGGGGTTGGATGG - Intergenic
986371152 5:7081489-7081511 CAAGACAGGGAGTGGGTGGAAGG + Intergenic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
986846650 5:11764102-11764124 CAGGAAAGTCAGAGTCAGGAAGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987298259 5:16573655-16573677 AGGCACAGGGAGAGGGAGGATGG + Intronic
987730887 5:21771059-21771081 GAGGACAGAGAGTGGGAGGAGGG + Intronic
988485566 5:31665641-31665663 CAGGAAAGGGAGGGGGGGGAGGG - Intronic
989093927 5:37763556-37763578 CAGGAAAAGCAGAGGAAGAAGGG + Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990517820 5:56546951-56546973 TAGGAGAGGCAAAGGGAAGAGGG - Intronic
991262845 5:64685554-64685576 CAGGAGAGGAAAAGGGAGTATGG + Intergenic
991404642 5:66289819-66289841 CAGGGCTGGCAGAGAGAGGTAGG - Intergenic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
992770582 5:80043592-80043614 CAGGACTGGGAGATGAAGGAGGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995441329 5:112195620-112195642 AAGGACAGTCAGAGGGAAGAAGG - Intronic
995831668 5:116361478-116361500 CAGGACCTGCGGAGGGAGGGAGG - Intronic
995837183 5:116410571-116410593 CAGGACAGGCAGAGAAAGGCAGG - Intronic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996338037 5:122406261-122406283 CAAGAAAGACAGGGGGAGGAGGG - Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997399465 5:133591271-133591293 CAAGACAGGGAGAGGAAGGCAGG + Intronic
997613273 5:135229939-135229961 CAGGGCAGGATGAGGGAGGAAGG - Intronic
997628413 5:135347492-135347514 CAGGACAGGTAGAGGCAGGAGGG - Intronic
997803285 5:136888500-136888522 CTTGCCAGGCAGAGGGATGAGGG - Intergenic
998080883 5:139274108-139274130 CAGCACCGGCAGAGGCCGGAGGG - Exonic
998172601 5:139881326-139881348 CAGGAGAGGCAGAGGCAGCTGGG - Intronic
998463887 5:142327755-142327777 CATCTCAGGCAGAGGGAGCATGG + Intergenic
998513855 5:142735581-142735603 CAAGGCAGGCAGAGAGAGGGTGG + Intergenic
998537732 5:142950216-142950238 CAGGACAGGCAGAAAGCTGAAGG + Intronic
998861052 5:146444851-146444873 CTTGACAGGCAGAGGTGGGAGGG - Intergenic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999151173 5:149427204-149427226 CAGGGCAGGAAGAGTGAGAAGGG + Intergenic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
999255641 5:150208728-150208750 CATGACAGGCAGAGGGATTTGGG + Intronic
999264095 5:150255335-150255357 CAGGACAGTCAGAGAGGGGCAGG + Intronic
999331915 5:150679419-150679441 TAGGAATGGCAGAGGTAGGAAGG - Intergenic
1000003950 5:157165911-157165933 GACGTCAGGCAGTGGGAGGATGG + Exonic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000313255 5:160064708-160064730 AAGCACAGGCTGAGGGTGGATGG + Intronic
1000503135 5:162077922-162077944 GAGGAAAGGAGGAGGGAGGAAGG + Intronic
1001116493 5:168945006-168945028 GAGGAAAGGAAGAGGAAGGAGGG + Intronic
1001155956 5:169272681-169272703 CAAGTCTGGCAGAGGGATGATGG - Intronic
1001480943 5:172088939-172088961 AAGGACTGGAACAGGGAGGAAGG - Intronic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1001765377 5:174241882-174241904 AAGGTCAGGGGGAGGGAGGAAGG - Intronic
1001970826 5:175953784-175953806 CGGGGCAGGCAGGGTGAGGATGG - Intronic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002246612 5:177889980-177890002 CGGGGCAGGCAGGGTGAGGATGG + Intergenic
1002499513 5:179638715-179638737 CTGGTCAGGCAGAGGGAAGCAGG - Intergenic
1002725019 5:181289079-181289101 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003059651 6:2853390-2853412 CAGGAGAGGGACAGGGAGGGGGG - Intergenic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1004233321 6:13852025-13852047 GAGGAGAGGGAGAGGGAGGGAGG - Intergenic
1004473279 6:15947868-15947890 CAGGAGAGGCACAGGAAGGAGGG + Intergenic
1005406902 6:25498996-25499018 AAGGTCAGGGAGTGGGAGGAGGG + Intronic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006163306 6:32050198-32050220 CAGGACAGGCTGAGGGAGTCGGG + Intronic
1006163930 6:32053588-32053610 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006164557 6:32056786-32056808 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006165556 6:32062357-32062379 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006166507 6:32068590-32068612 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006197455 6:32254759-32254781 GAGGGCAGGGAGAGGGAGGGGGG + Intergenic
1006451472 6:34108072-34108094 CAGCACAGGCTGGGTGAGGAGGG + Intronic
1006600531 6:35222526-35222548 CAGGACAGGGCGAGGCAGGGAGG + Intronic
1006985060 6:38170453-38170475 GAGGCGAGGCGGAGGGAGGAGGG - Exonic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007470025 6:42083793-42083815 CAAGACAAGCAAAGGAAGGAAGG + Intronic
1007609282 6:43138875-43138897 CAAGACAGCCAGCTGGAGGAGGG + Exonic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007728915 6:43933843-43933865 CAGGACAGCCAGAGGGGGCTGGG - Intergenic
1007741022 6:44009574-44009596 GAGGAAGGGAAGAGGGAGGAAGG + Intergenic
1007772127 6:44200732-44200754 CTGGACAGTGAGAGGGATGAGGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007932693 6:45706735-45706757 CAGGACAGGAAGTGGGTGCAAGG + Intergenic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1009828393 6:68897597-68897619 GAGGGCAGGAAGAGGAAGGAAGG + Intronic
1009828423 6:68897728-68897750 GAGGGCAGGAAGAGGAAGGAAGG + Intronic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011629691 6:89311711-89311733 CAGGGCCTGCACAGGGAGGAGGG - Intronic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1013258070 6:108409429-108409451 GATGGCAGGCACAGGGAGGAAGG + Intronic
1015382295 6:132583339-132583361 CAGAATAGGCAGAGGCAGCATGG + Intergenic
1015806570 6:137115805-137115827 TACAACAGGCAGAGAGAGGAAGG - Intergenic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1016544781 6:145208816-145208838 CAGGACAGGATGAGGGCTGAGGG - Intergenic
1017081482 6:150673595-150673617 AAAGACAGGAAGAGAGAGGAAGG - Intronic
1017127598 6:151080383-151080405 CAGGGCAGCCAGTGAGAGGATGG + Intronic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017885598 6:158597087-158597109 CATGACAGGCTCAGGCAGGAAGG - Intronic
1017906143 6:158758669-158758691 CAGCACAGGCAGTGGGAGAGTGG - Intronic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018681622 6:166270196-166270218 GAGGACAGGAGGATGGAGGAGGG + Intergenic
1018726468 6:166616654-166616676 CTGGCCTGGCAGAGGGAGGATGG - Intronic
1018808221 6:167277547-167277569 CAGGTCAGGCAGAGAGTGGACGG + Intronic
1018825890 6:167407639-167407661 CAGGGCAGGCAGAGCGGTGAAGG + Intergenic
1018838493 6:167502539-167502561 CAGGGCAGGCCCAGGGTGGAGGG - Intergenic
1018952656 6:168389232-168389254 GAGGGCAGGCAGAGGCATGAAGG - Intergenic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019100821 6:169627824-169627846 CAGCCCATGCAGAGGGAGGAGGG + Intronic
1019183420 6:170207261-170207283 CAGGAGTGGCACAGGGATGAAGG + Intergenic
1019329455 7:455467-455489 CAGGCCTGGCACAGGGAGGAGGG - Intergenic
1019354217 7:570513-570535 CTGGGCAGGCAGTGGGGGGACGG - Intronic
1019437098 7:1028009-1028031 CAGGAGAGTAAGTGGGAGGAGGG + Intronic
1019481768 7:1270231-1270253 GAGGACAGGCTGAGGGATGAGGG - Intergenic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019501224 7:1365656-1365678 CAGCACAGGGAGTGAGAGGAAGG + Intergenic
1019559703 7:1649895-1649917 CAGGAGAGGTAGAGGGGAGATGG + Intergenic
1019603353 7:1896149-1896171 GAGGTCAGGGAGAGGCAGGAAGG - Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019842660 7:3463809-3463831 CAGGACAGGCCATAGGAGGAGGG + Intronic
1020137230 7:5594149-5594171 CAGGACAGCCGGCGGGGGGAGGG - Intronic
1020741879 7:12030326-12030348 CAGGACAGGAGGGTGGAGGAAGG + Intergenic
1021420005 7:20435920-20435942 GAGGACAGGAAAAGAGAGGAAGG + Intergenic
1022108075 7:27210936-27210958 CAGGCCTGACAGAGGCAGGAGGG - Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022415674 7:30174781-30174803 GAGGACAGTCGGAGGGAGGGAGG + Intergenic
1022527381 7:31047084-31047106 GGGGACAGGCAGAGGGGGTACGG + Intergenic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022831853 7:34075645-34075667 CGTGATAGGCAGAGGGAGGGAGG - Intronic
1022953960 7:35364410-35364432 GAGTCCAGGCAGAGGGTGGAAGG - Intergenic
1023036526 7:36135948-36135970 CAGGAGAGGCAGTGGGTGGCAGG + Intergenic
1023135462 7:37047292-37047314 AAGGAAAGGCAGAGACAGGAAGG - Intronic
1023274460 7:38503009-38503031 CAGGGCAGGCAGCGTGATGATGG + Intronic
1023579431 7:41665705-41665727 CGGGACCGGCAGAGGGGGGGTGG + Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023856305 7:44186174-44186196 CAGGGCAGCTGGAGGGAGGAAGG + Intronic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024069920 7:45776692-45776714 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1024586840 7:50849529-50849551 AAGGACATGCACAGGGAGCAGGG - Intergenic
1024967770 7:55039461-55039483 CAAGACTGGCAGAGAGAAGAGGG + Intronic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026557181 7:71418721-71418743 CAGGACATCCCCAGGGAGGAGGG + Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027052433 7:75028669-75028691 GACGACGGGCTGAGGGAGGAAGG - Intronic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027145298 7:75689787-75689809 CAGGACTGGCTGTGGGACGAGGG + Intronic
1027171019 7:75872506-75872528 CCTGACAGGCACAGAGAGGAAGG + Intronic
1028437394 7:90820492-90820514 CAGGAGAGACAGAGCGAGGCAGG - Intronic
1028477531 7:91267012-91267034 CCCGACTGCCAGAGGGAGGATGG + Exonic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029097947 7:98104113-98104135 CAGGACAGACACTGGCAGGAGGG + Intergenic
1029348622 7:99997202-99997224 AAGGACAGAGGGAGGGAGGAGGG - Intergenic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1029728801 7:102425915-102425937 CAGAACAGGCTGAGAGAGGCGGG + Exonic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1031102448 7:117498786-117498808 GAAGACAGGCAGAGGAAAGAGGG - Intronic
1031777948 7:125924194-125924216 CAGGACTGGCAGAGGAGAGAAGG - Intergenic
1032047318 7:128620978-128621000 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1032211208 7:129915759-129915781 AAAGACAGGCAGAGTTAGGAGGG - Intronic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1033349714 7:140552356-140552378 AAGGAGAGGGAGAGGGAGGGAGG - Intronic
1033366853 7:140678532-140678554 CAGGACAGCGAGAGGCAGCAGGG + Intronic
1033439655 7:141367147-141367169 GTGGACCAGCAGAGGGAGGAAGG + Intronic
1033705206 7:143879870-143879892 CAGCAGAGGCTGAGGGAGAAGGG - Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034274509 7:149818127-149818149 AAGGACAGGCAGAAGGTGGTGGG + Intergenic
1034278969 7:149838561-149838583 CAGGCCAGGCCGCGGGGGGAGGG + Exonic
1034422079 7:150995672-150995694 TGGGACGGGGAGAGGGAGGAGGG - Intronic
1034422186 7:150995933-150995955 TGGGACGGGGAGAGGGAGGAAGG - Intronic
1034422198 7:150995965-150995987 TGGGACGGGGAGAGGGAGGAAGG - Intronic
1034475024 7:151276836-151276858 GAAGCCAGGCAGGGGGAGGAGGG + Intronic
1034475050 7:151276905-151276927 GATGCCAGGCAGGGGGAGGAGGG + Intronic
1034478926 7:151304934-151304956 GAGGACAGGAAGTGGGAGGTGGG - Intergenic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034956192 7:155336826-155336848 TAGGACAGGCAGGGAGAGGGTGG - Intergenic
1035239687 7:157521492-157521514 CAGGGCAGTGAGTGGGAGGAGGG + Intergenic
1035275427 7:157745409-157745431 GAGGACAGGCTGCGGGAGGCAGG + Intronic
1035275437 7:157745440-157745462 GAGGACAGGCTGTGGGAGGCAGG + Intronic
1035275446 7:157745471-157745493 CAGGGCAGGCTCAGGGAGGCAGG + Intronic
1035354669 7:158270015-158270037 CAGGTCAGGCAGAGAGTGGACGG - Intronic
1035522926 8:289962-289984 AAGGAAAGGAAGAGGGAAGAAGG - Intergenic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1035724152 8:1814077-1814099 CAGGACGTGGTGAGGGAGGATGG - Intergenic
1035737790 8:1901299-1901321 CAGGAGAGTCACTGGGAGGAAGG - Intronic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035764050 8:2091556-2091578 CACGACAGAGAGAGGGTGGAGGG - Intronic
1035859217 8:3010013-3010035 CAGGATAGGCCCAGGGAAGAAGG - Intronic
1036812882 8:11879844-11879866 AAGGACAGGCAGAGTGGGGCAGG - Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037134758 8:15446729-15446751 CAGGAGAGGGGGAGGGAGGGGGG + Intronic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037602124 8:20406099-20406121 CAAGCCAGGCAGATAGAGGAGGG - Intergenic
1037648310 8:20813852-20813874 TAGGACAGGAATATGGAGGATGG - Intergenic
1037881989 8:22578065-22578087 CAGGACGGTCTGTGGGAGGAGGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1039032796 8:33328175-33328197 CAGGACAGGCTGTCCGAGGAGGG + Intergenic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1039893115 8:41697657-41697679 CCGGACAGGCTCAGGCAGGAGGG - Intronic
1040319836 8:46286959-46286981 TGGGACAGGCAGAGGGGAGAAGG - Intergenic
1040332293 8:46391780-46391802 TAAGACAGGCAGAGGGGAGAAGG + Intergenic
1040981043 8:53246412-53246434 CATGACAGGCAGGAGGATGAAGG + Intronic
1041125663 8:54635967-54635989 GAGGAGAGGAAGAGGGAGAAAGG - Intergenic
1041167190 8:55102054-55102076 GAGGAGAGGAAGCGGGAGGAGGG + Intergenic
1041214967 8:55591321-55591343 GAAGACAAGCAGGGGGAGGATGG + Intergenic
1041237669 8:55820831-55820853 AAGGACAGAGAGAGGGAGAACGG - Intronic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1042214666 8:66418218-66418240 CAGGAGAGGAAAAGGGTGGAAGG + Intergenic
1042249967 8:66746218-66746240 GAGAACAGGCAGAGGTTGGAGGG - Intronic
1043269300 8:78309822-78309844 CAGGTAAGGGAGTGGGAGGAGGG - Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1045169124 8:99644074-99644096 CAGGAGAGGCAGAGGAAAGTAGG + Intronic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1045494973 8:102700491-102700513 CAGGACAGGCCAGGGGAGAAGGG + Intergenic
1045674098 8:104589082-104589104 CAGGCGAGCCGGAGGGAGGAGGG - Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1047214297 8:122864203-122864225 AGGGACAGGCAGTGGGAGGAGGG + Intronic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048297717 8:133226974-133226996 CACGAGAGGCAAAGGCAGGAGGG + Intronic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048862983 8:138737355-138737377 CAGCACAGGAGGAGGGAGGGAGG + Intronic
1048880784 8:138870985-138871007 CAGGCCAGGCAGAGGGATGTGGG + Intronic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1049291632 8:141806374-141806396 CAGGACATGGAAAGGAAGGAGGG - Intergenic
1049325266 8:142018249-142018271 GAGGACAAGCAGCGGGAGGGGGG - Intergenic
1049343530 8:142126594-142126616 CAGGAGAGGAAGAGGGACGGCGG + Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049829916 8:144693907-144693929 CAAGTCAGGCAAAGGGGGGAGGG + Intergenic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050585277 9:7104341-7104363 CAGTAAAGGAAGAGGTAGGATGG + Intergenic
1052434593 9:28409929-28409951 AAGGAAAGGAAGAGGGAGAAAGG + Intronic
1052754146 9:32523709-32523731 CAAGACAGGGAGAGAGAGAATGG - Intronic
1053444709 9:38143116-38143138 GAAGGCAGGCTGAGGGAGGATGG - Intergenic
1053696841 9:40647385-40647407 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054308092 9:63446618-63446640 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054406825 9:64770609-64770631 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054440450 9:65256075-65256097 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054489957 9:65765849-65765871 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1054805905 9:69395747-69395769 AAGAACTGGCAGAGGAAGGAGGG + Intergenic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055360122 9:75480722-75480744 CAGGATAGGCAAACAGAGGAGGG + Intergenic
1055935213 9:81598359-81598381 CGTGGCAGGCAGAGGGAGGGAGG - Intronic
1056033931 9:82584082-82584104 CAGGACAGGAGGAGTGATGATGG + Intergenic
1056163160 9:83918334-83918356 CAGGACAGGGAGGGAGAGGAGGG + Intronic
1056366745 9:85912561-85912583 CAGGAAAGGGAGAGTGGGGAAGG + Intergenic
1056408387 9:86299062-86299084 CAGGTCAGCCAGAGGAAGGAGGG + Intronic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056858637 9:90158839-90158861 CAGGCCAGGAGCAGGGAGGAGGG - Intergenic
1056889950 9:90482635-90482657 CAGGTCTGGCAGATGTAGGAAGG + Intergenic
1056954533 9:91071761-91071783 CAGAAAAGGCAGAGGGATGTGGG + Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057937499 9:99253163-99253185 CAGGACTGAGAGAGAGAGGAGGG + Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058704542 9:107627745-107627767 GAGGACAGGCAGAGGGGAGGAGG - Intergenic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059247547 9:112861646-112861668 CAAGACTGGCAGAGGGTGGCAGG - Intronic
1059292143 9:113235658-113235680 CATGACTGGGAGAGGCAGGAGGG + Intronic
1059740660 9:117146307-117146329 CAGGAAAGGGAGGGAGAGGAGGG + Intronic
1060176814 9:121503320-121503342 GAGGACAGGGTGAGAGAGGATGG - Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060578974 9:124726309-124726331 CAGGACAGTTAGGGGCAGGAGGG - Intronic
1060789973 9:126479316-126479338 CAGGTCAGGCAGATGGTGGTGGG + Intronic
1060931373 9:127491516-127491538 CAGGAGGGTCAGAGGAAGGAGGG + Intronic
1061022069 9:128022423-128022445 CAGGACAGAAAGAGGCAAGAGGG + Intergenic
1061291043 9:129650451-129650473 CGAGAGAGGCAGAGGCAGGAAGG + Intergenic
1061315774 9:129794997-129795019 CAGGACAGGCAGGGATGGGATGG + Intergenic
1061370756 9:130196119-130196141 CAAGACAGGCACTGGGAGGGAGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061417578 9:130455493-130455515 AAGGACAGGTAGGGGGATGATGG - Intronic
1061573703 9:131493155-131493177 GAGGACAGGCAAAGGGCGGTGGG - Intronic
1061875679 9:133542404-133542426 CAGGGCATGCAGAGGGAGAGTGG + Intronic
1062340356 9:136091307-136091329 CAGGACGGCCTCAGGGAGGACGG + Intronic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1062398599 9:136362723-136362745 GAGGGCAGGCAGAGGCAGGGAGG + Intronic
1062513909 9:136922684-136922706 GAGGACAGGGATGGGGAGGATGG + Intronic
1062551498 9:137089540-137089562 CAGGGCTGGGAGAGGGAGCAGGG + Intronic
1062750163 9:138246726-138246748 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1202779293 9_KI270717v1_random:21044-21066 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1203617107 Un_KI270749v1:75774-75796 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1185511232 X:666524-666546 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185511253 X:666613-666635 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185511293 X:666791-666813 CAGGCCTGGGAGAGGCAGGAAGG + Intergenic
1185575535 X:1169176-1169198 GAGGACAGGGAGGGGGAGGGAGG + Intergenic
1185621959 X:1455469-1455491 CAGGAGCGGGAGAGGCAGGAAGG - Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186385342 X:9105187-9105209 CAGGACAGTCTGGGGGAGGGGGG - Intronic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186540964 X:10399280-10399302 CAGGCCAGGCAGTGGGTGGAAGG + Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187208765 X:17208453-17208475 AAAGAAAGGAAGAGGGAGGAAGG + Intergenic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1187715483 X:22098187-22098209 CAGGACAGAGAAAGGGAGGGAGG + Intronic
1187775465 X:22751600-22751622 GAGGACAGGCACAGGGAAAACGG + Intergenic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189231259 X:39454167-39454189 CCGGTCAGGCAGAGGGCAGACGG + Intergenic
1189446680 X:41086375-41086397 CAGGACGGGAAGGGGGAGGAGGG - Intronic
1189465745 X:41276447-41276469 CAGAACCCGCGGAGGGAGGAGGG + Intergenic
1189650974 X:43189129-43189151 CAGGACAGACAGAGCGATGGAGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190057415 X:47189793-47189815 AAGGAGAGGGAGAGGGAGGGTGG - Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190734709 X:53248653-53248675 AAGGACAGCAAGAGGGAGGAAGG - Intronic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1192140651 X:68644928-68644950 CAGGACAAGACGAGAGAGGAAGG + Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192569343 X:72190041-72190063 CAGGATTGGCGGAGGCAGGAAGG - Intronic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194557783 X:95383280-95383302 CAGGACTGGCAGAGTTAGGTTGG + Intergenic
1195706392 X:107740944-107740966 CATGACAGGCATTGGGAGTAGGG + Intronic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196758098 X:119175803-119175825 CAGGACAAGAAGGGAGAGGAGGG - Intergenic
1197112678 X:122795292-122795314 AGGGTCAGGGAGAGGGAGGAGGG + Intergenic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1199105583 X:143862870-143862892 CAGGAAAAGCAGAGGTAGAAGGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199451358 X:147981778-147981800 GAGGACAGGAAGGGGCAGGAAGG - Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199942918 X:152641983-152642005 CAGGACCGGGGGAGGGAGCAGGG + Intronic
1200114155 X:153762810-153762832 AAGGACAGGGAGAGGGAGAGAGG + Intergenic
1200957968 Y:8970565-8970587 CACAAATGGCAGAGGGAGGAGGG - Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201194569 Y:11479325-11479347 CAGGACAGCCCGAAGGAGGGGGG + Intergenic