ID: 985493179

View in Genome Browser
Species Human (GRCh38)
Location 5:191015-191037
Sequence CCTTTCCACAGTGGCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985493179_985493187 3 Left 985493179 5:191015-191037 CCCCAGAGGCCACTGTGGAAAGG No data
Right 985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG No data
985493179_985493188 4 Left 985493179 5:191015-191037 CCCCAGAGGCCACTGTGGAAAGG No data
Right 985493188 5:191042-191064 TGGTTACCGAGTGAGGCGCAGGG No data
985493179_985493189 5 Left 985493179 5:191015-191037 CCCCAGAGGCCACTGTGGAAAGG No data
Right 985493189 5:191043-191065 GGTTACCGAGTGAGGCGCAGGGG No data
985493179_985493186 -3 Left 985493179 5:191015-191037 CCCCAGAGGCCACTGTGGAAAGG No data
Right 985493186 5:191035-191057 AGGGAACTGGTTACCGAGTGAGG No data
985493179_985493191 10 Left 985493179 5:191015-191037 CCCCAGAGGCCACTGTGGAAAGG No data
Right 985493191 5:191048-191070 CCGAGTGAGGCGCAGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985493179 Original CRISPR CCTTTCCACAGTGGCCTCTG GGG (reversed) Intergenic
No off target data available for this crispr