ID: 985493183

View in Genome Browser
Species Human (GRCh38)
Location 5:191017-191039
Sequence TCCCTTTCCACAGTGGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985493183_985493188 2 Left 985493183 5:191017-191039 CCAGAGGCCACTGTGGAAAGGGA No data
Right 985493188 5:191042-191064 TGGTTACCGAGTGAGGCGCAGGG No data
985493183_985493186 -5 Left 985493183 5:191017-191039 CCAGAGGCCACTGTGGAAAGGGA No data
Right 985493186 5:191035-191057 AGGGAACTGGTTACCGAGTGAGG No data
985493183_985493189 3 Left 985493183 5:191017-191039 CCAGAGGCCACTGTGGAAAGGGA No data
Right 985493189 5:191043-191065 GGTTACCGAGTGAGGCGCAGGGG No data
985493183_985493191 8 Left 985493183 5:191017-191039 CCAGAGGCCACTGTGGAAAGGGA No data
Right 985493191 5:191048-191070 CCGAGTGAGGCGCAGGGGCCTGG No data
985493183_985493187 1 Left 985493183 5:191017-191039 CCAGAGGCCACTGTGGAAAGGGA No data
Right 985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985493183 Original CRISPR TCCCTTTCCACAGTGGCCTC TGG (reversed) Intergenic
No off target data available for this crispr