ID: 985493185

View in Genome Browser
Species Human (GRCh38)
Location 5:191024-191046
Sequence AACCAGTTCCCTTTCCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985493185_985493189 -4 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493189 5:191043-191065 GGTTACCGAGTGAGGCGCAGGGG No data
985493185_985493194 25 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493194 5:191072-191094 CTGTTCTCTGCCCCGTTGACTGG No data
985493185_985493196 29 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493196 5:191076-191098 TCTCTGCCCCGTTGACTGGTGGG No data
985493185_985493197 30 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493197 5:191077-191099 CTCTGCCCCGTTGACTGGTGGGG No data
985493185_985493188 -5 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493188 5:191042-191064 TGGTTACCGAGTGAGGCGCAGGG No data
985493185_985493195 28 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493195 5:191075-191097 TTCTCTGCCCCGTTGACTGGTGG No data
985493185_985493187 -6 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG No data
985493185_985493191 1 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493191 5:191048-191070 CCGAGTGAGGCGCAGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985493185 Original CRISPR AACCAGTTCCCTTTCCACAG TGG (reversed) Intergenic
No off target data available for this crispr