ID: 985493187

View in Genome Browser
Species Human (GRCh38)
Location 5:191041-191063
Sequence CTGGTTACCGAGTGAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985493183_985493187 1 Left 985493183 5:191017-191039 CCAGAGGCCACTGTGGAAAGGGA No data
Right 985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG No data
985493185_985493187 -6 Left 985493185 5:191024-191046 CCACTGTGGAAAGGGAACTGGTT No data
Right 985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG No data
985493181_985493187 2 Left 985493181 5:191016-191038 CCCAGAGGCCACTGTGGAAAGGG No data
Right 985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG No data
985493179_985493187 3 Left 985493179 5:191015-191037 CCCCAGAGGCCACTGTGGAAAGG No data
Right 985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985493187 Original CRISPR CTGGTTACCGAGTGAGGCGC AGG Intergenic
No off target data available for this crispr