ID: 985493602

View in Genome Browser
Species Human (GRCh38)
Location 5:192895-192917
Sequence CTCCCTCGAGGGAGACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985493602_985493614 14 Left 985493602 5:192895-192917 CCTCCCAGTCTCCCTCGAGGGAG 0: 1
1: 0
2: 3
3: 23
4: 176
Right 985493614 5:192932-192954 CTGCATGGACCTCCCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 146
985493602_985493610 -1 Left 985493602 5:192895-192917 CCTCCCAGTCTCCCTCGAGGGAG 0: 1
1: 0
2: 3
3: 23
4: 176
Right 985493610 5:192917-192939 GGCCTGGGCTCCATGCTGCATGG 0: 1
1: 0
2: 4
3: 53
4: 588
985493602_985493615 15 Left 985493602 5:192895-192917 CCTCCCAGTCTCCCTCGAGGGAG 0: 1
1: 0
2: 3
3: 23
4: 176
Right 985493615 5:192933-192955 TGCATGGACCTCCCCATGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 82
985493602_985493616 20 Left 985493602 5:192895-192917 CCTCCCAGTCTCCCTCGAGGGAG 0: 1
1: 0
2: 3
3: 23
4: 176
Right 985493616 5:192938-192960 GGACCTCCCCATGGTGGGACAGG 0: 1
1: 0
2: 1
3: 11
4: 152
985493602_985493613 11 Left 985493602 5:192895-192917 CCTCCCAGTCTCCCTCGAGGGAG 0: 1
1: 0
2: 3
3: 23
4: 176
Right 985493613 5:192929-192951 ATGCTGCATGGACCTCCCCATGG 0: 1
1: 0
2: 1
3: 11
4: 158
985493602_985493618 23 Left 985493602 5:192895-192917 CCTCCCAGTCTCCCTCGAGGGAG 0: 1
1: 0
2: 3
3: 23
4: 176
Right 985493618 5:192941-192963 CCTCCCCATGGTGGGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985493602 Original CRISPR CTCCCTCGAGGGAGACTGGG AGG (reversed) Intronic
901679731 1:10906129-10906151 CTCCCTCGAGGGACACACTGTGG + Intergenic
902392765 1:16115878-16115900 CTCCCTCGTGGGGGACTGGGGGG + Intergenic
903149791 1:21398557-21398579 ATCCCTCGAGAGAGAAGGGGTGG - Intergenic
903213916 1:21832841-21832863 CTCCCTCAAGGGGGAGAGGGAGG + Intronic
903499019 1:23791677-23791699 CTCCGAGGAGGGAGCCTGGGCGG + Intronic
903765564 1:25732087-25732109 ATCCCTCGAGGGCATCTGGGGGG + Intronic
904062894 1:27725448-27725470 CTCCTTTGAGCGAGGCTGGGCGG + Intergenic
904524452 1:31122252-31122274 CTGCCTCCAGGCAGACCGGGAGG - Intergenic
905945522 1:41898315-41898337 CCCCCTCCAGGGAGACTGCCAGG - Intronic
907192328 1:52659825-52659847 CACTTTCAAGGGAGACTGGGAGG + Intronic
910683861 1:89896206-89896228 CTCCCTTGTGGGTGAGTGGGAGG + Intronic
913961963 1:143346448-143346470 CTCCCTGGAGGGAGCTTGGGTGG + Intergenic
914056318 1:144172022-144172044 CTCCCTGGAGGGAGCTTGGGTGG + Intergenic
914122828 1:144794340-144794362 CTCCCTGGAGGGAGCTTGGGTGG - Intergenic
916016700 1:160756162-160756184 CCTCCTCGAGTGAGAATGGGTGG + Intergenic
916560911 1:165933618-165933640 CTCCCTCAGGGCAGTCTGGGAGG - Intergenic
917291433 1:173476275-173476297 GTGCCTAGAGGGTGACTGGGGGG - Intergenic
1063093355 10:2887558-2887580 CTCCCTCACGGGAGACAGTGAGG - Intergenic
1069534264 10:69241416-69241438 ATCCCCTGAGGGAGACTGGAAGG + Intronic
1071532998 10:86403022-86403044 CTTCCTCCAGGCAGACTGAGTGG - Intergenic
1072550774 10:96475677-96475699 GTCCCTGGAGGGAGACATGGGGG - Intronic
1073515418 10:104071493-104071515 TTCCATCGACAGAGACTGGGGGG + Intronic
1078384670 11:10878838-10878860 GTCACTAGAGAGAGACTGGGAGG + Intergenic
1078430121 11:11281898-11281920 CTCCCTCCCTGGAGGCTGGGAGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1082911156 11:58375926-58375948 CTCCAGCCAGGGACACTGGGGGG - Intergenic
1084161928 11:67354849-67354871 TTCCTTCCAGGGATACTGGGAGG + Intronic
1084681686 11:70670089-70670111 CTCCCCACAGAGAGACTGGGTGG + Intronic
1089065054 11:115656428-115656450 CTCCCAGGAGGGGGACTGGGAGG - Intergenic
1089795851 11:120980285-120980307 CCCTGTCGAGGGAGGCTGGGTGG - Intronic
1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG + Intronic
1091584450 12:1808141-1808163 GTCCCTCGAGGGACCCTGGAGGG + Intronic
1096409945 12:51369706-51369728 CTGACGTGAGGGAGACTGGGGGG - Intronic
1107624830 13:42271996-42272018 CTCTCGCGAGAGAGAGTGGGAGG + Intergenic
1112030331 13:95450706-95450728 CTCCCTCCAGGGAGAATGGGAGG - Intronic
1113667838 13:112153289-112153311 CTCCCTAGAGAGAGACTGGAAGG - Intergenic
1113799572 13:113079362-113079384 CTTCCTCGAGGGCCTCTGGGAGG - Intronic
1113936205 13:113996350-113996372 CTCCCTCGAGGGAGCATCTGGGG - Intronic
1116536201 14:46034353-46034375 CTTCCTCAAGGGATGCTGGGAGG + Intergenic
1118321805 14:64757766-64757788 CTCCCTGGAGGGGGACAAGGAGG + Intronic
1121238629 14:92412075-92412097 CTCTGTAGAGGGAGACTGGCTGG - Intronic
1122986169 14:105212667-105212689 GTCCCCCCAGGGAGACAGGGGGG + Intronic
1123147063 14:106142225-106142247 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
1123176210 14:106421648-106421670 CTCCCTGCAGGGAGGCTGAGGGG - Intergenic
1123218211 14:106831670-106831692 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
1202947476 14_KI270726v1_random:41917-41939 CTCCCTGCAGGGAGGCTGAGGGG + Intergenic
1124220862 15:27848488-27848510 CTCCGTCAATGGAAACTGGGAGG - Intronic
1126512092 15:49489362-49489384 CTTCCTTGAGGGATACTGCGTGG + Intronic
1128551567 15:68601061-68601083 CTCCCTCGATGGGGATGGGGTGG + Intronic
1129867643 15:78921699-78921721 CTCCCTCCTGGGAGACTGAGTGG + Exonic
1130282477 15:82530916-82530938 CAGCCTGGAGGGAGACTGAGGGG - Intergenic
1134523887 16:14930263-14930285 CACCCTGGAGGGACTCTGGGCGG - Intronic
1134549017 16:15130672-15130694 CACCCTGGAGGGACTCTGGGCGG + Intronic
1134711478 16:16328748-16328770 CACCCTGGAGGGACTCTGGGCGG - Intergenic
1134719329 16:16372047-16372069 CACCCTGGAGGGACTCTGGGCGG - Intergenic
1134948097 16:18339838-18339860 CACCCTGGAGGGACTCTGGGCGG + Intergenic
1134955351 16:18379945-18379967 CACCCTGGAGGGACTCTGGGCGG + Intergenic
1138597821 16:58038531-58038553 TTCCCTCGAGGGAGACTGCCTGG - Intronic
1140051395 16:71484479-71484501 CTCAGTGGAGGGAGACAGGGCGG - Intronic
1142862463 17:2771147-2771169 CTCTCTGGAGGGAGAGTGGCAGG + Intergenic
1143523872 17:7461716-7461738 TTCCCTGGAGGAAGACTGAGAGG + Exonic
1145864139 17:28229181-28229203 CTACCTCCAGGGAGGCTGGAGGG - Intergenic
1147773067 17:42880820-42880842 ATCCCTGGTGGGAGTCTGGGAGG + Intergenic
1147926705 17:43951066-43951088 CTACCTCCAGGGAGGCTGGAGGG + Intergenic
1150469460 17:65424617-65424639 CTCTCTTGATGGAGACTGGTGGG - Intergenic
1152426480 17:80220990-80221012 GGCGCTCGAGGGAGAGTGGGGGG - Exonic
1152484182 17:80578917-80578939 CACCCTCCAGGGAGGCTGGCAGG - Intronic
1152519810 17:80848845-80848867 CTTCCTTGAGGGAGTGTGGGTGG - Intronic
1157725702 18:49962021-49962043 CTCTCTTGGGGGAGCCTGGGTGG - Intronic
1160715295 19:573549-573571 GCCCCTCGAGGGAGCCTGCGAGG - Intronic
1160715296 19:573558-573580 CTCCCTCGAGGGGCCCTGCGTGG + Intronic
1161664720 19:5568238-5568260 CTCCAGGGAGGGAGGCTGGGAGG + Intergenic
1161805764 19:6442145-6442167 CACCCTCGATGGAGGCTGGGAGG + Exonic
1162444454 19:10713572-10713594 CTCCCTCCAAGGTGGCTGGGGGG - Intergenic
1162797903 19:13096020-13096042 CTCCCTCAAGGGAGGGTTGGGGG + Exonic
1162934471 19:13974649-13974671 CTCCGTCGAGGGGGACAGGCAGG + Intronic
1163483724 19:17574183-17574205 CTGCGTAGATGGAGACTGGGTGG + Intronic
1164388059 19:27793841-27793863 ATCCCTGGAGGGAGACAGCGCGG + Intergenic
1165198813 19:34128879-34128901 CATCCTAGAGGGAGACTGAGGGG - Intergenic
1165861422 19:38911450-38911472 CTTCCTCCAGGTAGCCTGGGTGG + Intronic
1166077933 19:40424978-40425000 CTGCTTCGAGGAAGACTGTGGGG + Intronic
1166524981 19:43504958-43504980 GGGGCTCGAGGGAGACTGGGAGG - Intergenic
1166679823 19:44759458-44759480 GTCCCTGGGGGGAGACTGGGAGG - Exonic
1167369025 19:49070010-49070032 CTCCCTAGAGGGAGGGAGGGAGG - Exonic
1167403248 19:49286944-49286966 CTCCCCAAAAGGAGACTGGGGGG - Intergenic
1168100480 19:54138487-54138509 CTCCCTCGACGGTGGCGGGGAGG + Intronic
1202695800 1_KI270712v1_random:124709-124731 CTCCCTGGAGGGAGCTTGGGTGG + Intergenic
925554978 2:5120980-5121002 CTCCCTGGAGGGAGAGAGGATGG - Intergenic
925972185 2:9113482-9113504 TTCCCTCTAGGGAGGCGGGGCGG - Intergenic
926162964 2:10501316-10501338 CTCTCTCGCTGGAGTCTGGGTGG + Intergenic
927971432 2:27308067-27308089 CTCCGGGGAGGGAGGCTGGGTGG - Intronic
929553174 2:42907031-42907053 CTGCCTCGAGGGAGTGGGGGAGG + Intergenic
934276963 2:91581747-91581769 CTCCCTGGAGGGAGCTTGGGTGG + Intergenic
934513172 2:94964478-94964500 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
935326578 2:101943081-101943103 CTCCCTCCAGAGAGTCTGGAGGG - Intergenic
936663326 2:114566694-114566716 CTCACTTAAGGGAGACTTGGTGG - Intronic
936855176 2:116949290-116949312 CTACCTCCAGGGATACTGTGAGG - Intergenic
937262938 2:120597986-120598008 CAGCCACTAGGGAGACTGGGCGG - Intergenic
937968544 2:127532995-127533017 CTCCCTGGATGGACCCTGGGAGG - Intergenic
938029269 2:127978329-127978351 CTTCCTGGAGGGAGCCTGGCAGG - Intronic
944671224 2:201996065-201996087 CTCCCTCGGGAGAGCCTGGTTGG - Intergenic
946088353 2:217197027-217197049 CTCCCTCCAGGGTCTCTGGGAGG + Intergenic
947538936 2:230961162-230961184 CTCCCCCGATGGAGACTGGAAGG - Intergenic
947875430 2:233464582-233464604 CACCCTCGGGGGAGGCTGTGGGG - Intronic
948862343 2:240758725-240758747 CCCCCTGGAGGGAGTTTGGGAGG - Intronic
949017357 2:241720877-241720899 CTCCCTCAGGCGAGACTGAGAGG + Intronic
1169327586 20:4687381-4687403 CTCCCTCCAGGGGGACTGGGAGG - Intronic
1169759858 20:9079446-9079468 ATCCCTCCAGGGAGACAGAGGGG + Intronic
1170620317 20:17990394-17990416 CTCCCTTGAGGGACATTGGGGGG + Exonic
1172303997 20:33868780-33868802 CTCCCTCCAGAGAGAGTGGCAGG - Intergenic
1172614340 20:36273712-36273734 CTTACTGGATGGAGACTGGGTGG - Intergenic
1172768045 20:37361502-37361524 CTCCCTCCAGGGACACTGGTGGG - Intronic
1173788621 20:45813059-45813081 CTCTCCCGAAGGAGAATGGGAGG + Intronic
1173886426 20:46463213-46463235 CTCCAGCCAGGGAGCCTGGGTGG + Intergenic
1174106091 20:48163329-48163351 CTCCTTCGAGGGAGACTTTAAGG - Intergenic
1174767231 20:53265600-53265622 CTTCCCCGAGGGAGCCAGGGAGG - Intronic
1175646391 20:60676549-60676571 CGCCTTCGAGGAAGACAGGGAGG + Intergenic
1175763805 20:61579262-61579284 CTCCATCGAGGGAGATTTAGAGG - Intronic
1178692773 21:34763570-34763592 CTCCTCCCATGGAGACTGGGAGG + Intergenic
1179065920 21:38024855-38024877 CTCCCTGAAGGGAGACGGTGTGG - Intronic
1181098577 22:20523242-20523264 CTCCCTGGATGGAGTCTGGCTGG + Intronic
1181521240 22:23449895-23449917 CTCCCCCGAGGGACGCTGGAGGG + Intergenic
1181639875 22:24190834-24190856 CATCCTGGAGGGAGACTGGTGGG - Intergenic
1181888677 22:26041936-26041958 CTCCCACCAGTGAGACTGAGAGG - Intergenic
1182484152 22:30629264-30629286 CTCCCACGTGGAAGAATGGGGGG - Intergenic
1182764252 22:32747012-32747034 CTGGCTGGAGGGAGCCTGGGTGG + Intronic
1182772861 22:32808402-32808424 CTGCCGAGAGGGAGGCTGGGTGG + Intronic
1183317517 22:37145075-37145097 CTCCCTCGAGGGACAGTGAGGGG - Intronic
1184621176 22:45679158-45679180 CTCACTCTAGTGAGACTGGTAGG - Intronic
949612312 3:5715408-5715430 CTCCCTGGTGGGACACTGTGGGG - Intergenic
950548240 3:13651755-13651777 CTCCCCTGAGGGAGACAGGCGGG + Intergenic
955401521 3:58595134-58595156 CTGCTTCGAGTGGGACTGGGGGG - Intronic
956946463 3:74228892-74228914 CACCCTAGAGGTAGACTGTGGGG - Intergenic
962371483 3:134824299-134824321 GTCCCTGGAAGGAGAATGGGAGG + Intronic
964460916 3:156926547-156926569 ATCCCTCAAAGGAGACTAGGGGG - Intronic
966727728 3:183122687-183122709 CTCTCTGGAAGGAGACTGAGGGG - Exonic
968410713 4:387288-387310 CTCCCTCGGAGGAGACCTGGAGG - Intergenic
968453687 4:686846-686868 CGCCCTCGGGGGAGGCAGGGTGG - Intronic
968730770 4:2268272-2268294 CTCCCTCGAGGGGCTGTGGGAGG + Intergenic
968819366 4:2837929-2837951 CTCCCTCCAGTGAGAATGGCTGG - Exonic
969033802 4:4234640-4234662 CTCCCTGGAGGGAGCTTGGGTGG - Intergenic
970407515 4:15778173-15778195 CTCCCTGGAGGTGGAGTGGGTGG + Intergenic
975888228 4:78991712-78991734 CTCTCAGGAGGGAGACTGGAAGG + Intergenic
980009301 4:127578712-127578734 CTCCCTCCAGGCAGGCTGAGAGG - Intergenic
982875685 4:160646574-160646596 CTCCCTCAAGGGGCAATGGGAGG - Intergenic
985493602 5:192895-192917 CTCCCTCGAGGGAGACTGGGAGG - Intronic
986138877 5:5010886-5010908 GGCACTAGAGGGAGACTGGGAGG + Intergenic
987258118 5:16178929-16178951 CTCACTGGAGGCAAACTGGGAGG + Intronic
991470114 5:66959116-66959138 CTCTCTCGAGGGGGAGGGGGAGG - Intronic
992399959 5:76403158-76403180 CTCCCCCGGGGGAGAAGGGGCGG + Intergenic
993415123 5:87618703-87618725 CTCCATCGAGGAAAAGTGGGTGG - Intergenic
996036261 5:118762402-118762424 CTGGCTCTAGGGAGTCTGGGTGG + Intergenic
999327095 5:150650212-150650234 CGCCCTGGAGGGAGACACGGGGG - Exonic
999546164 5:152630904-152630926 CTTCCACCAGGCAGACTGGGAGG + Intergenic
1001288596 5:170440767-170440789 CTACCTCCAGGGAGAGTTGGGGG + Intronic
1001928555 5:175657229-175657251 CTCCGTGGAGGGAGCCTGGGTGG - Intergenic
1004714573 6:18204816-18204838 TTCCCATGAGGGAGAGTGGGAGG + Intronic
1006144212 6:31948583-31948605 CTACCTTGAGGGCGACAGGGAGG + Intronic
1006313305 6:33276635-33276657 CTACATATAGGGAGACTGGGGGG - Intergenic
1006804139 6:36777501-36777523 CTCCCTGGAGGGGGCCTGTGTGG + Intronic
1015486826 6:133781102-133781124 TTCCGTCAGGGGAGACTGGGAGG - Intergenic
1017739306 6:157392795-157392817 GTCTCTAGAGGGAGACAGGGAGG - Intronic
1018279997 6:162175182-162175204 TTGCCTGGAGGGAGACTTGGAGG - Intronic
1019178847 6:170175136-170175158 ATTCCTCGAGGGAGGCTGGGGGG - Intergenic
1019337210 7:491140-491162 CTCCCTCAGGGGACTCTGGGAGG - Intergenic
1019464003 7:1176428-1176450 CTCCTTCGAGGGAGGCTGTAGGG + Intergenic
1019614584 7:1953382-1953404 CTCCCTGGCGGGGGCCTGGGTGG - Intronic
1024382451 7:48713315-48713337 GTCACTTGAGGGACACTGGGTGG - Intergenic
1025084323 7:56010210-56010232 CTCCCTGGAGGAAAAATGGGGGG - Intergenic
1026895941 7:74010173-74010195 CACCCTGGAGGGAGAATAGGGGG + Intergenic
1027673936 7:81136107-81136129 GTCCCTTGAGTGAGACTTGGGGG - Intergenic
1030088594 7:105838010-105838032 CTCCCTTGAAGGAGGCTGGAGGG - Intronic
1031483014 7:122300547-122300569 ATCCCGGGAGGGCGACTGGGGGG - Intergenic
1031978522 7:128108779-128108801 CCCACTCCAGGGAGACTGGTTGG + Intergenic
1033614621 7:143002253-143002275 CTCCCTCGAGGCAGGATGGTGGG - Intergenic
1034550443 7:151817165-151817187 CGCCCTCCAGGGAGAGTAGGTGG - Intronic
1039918154 8:41874974-41874996 CACCCTCAGGAGAGACTGGGTGG + Intronic
1043486291 8:80702156-80702178 CTCACTCCAGGTAGACGGGGTGG - Intronic
1045420804 8:102013150-102013172 CTCCCTTGAGGGAGCATGGAGGG - Intronic
1047585598 8:126268738-126268760 CTCCCTCCTGGGAGACTGGCTGG - Intergenic
1049530407 8:143151693-143151715 TCCCCTTGAGGGAGACAGGGAGG - Intergenic
1049657996 8:143807268-143807290 CTCACTCGAGGGTGGCAGGGGGG - Intronic
1049851855 8:144836843-144836865 CTCCCTCGCTGCAGACTGGGTGG - Intronic
1053884370 9:42631707-42631729 CTTCCTTGAGGGATACTGCGTGG + Intergenic
1053888298 9:42662587-42662609 CTTCCTTGAGGGATACTGCGTGG - Intergenic
1054223394 9:62439154-62439176 CTTCCTTGAGGGATACTGCGTGG + Intergenic
1054227317 9:62470033-62470055 CTTCCTTGAGGGATACTGCGTGG - Intergenic
1055343345 9:75308805-75308827 CTGGCTCCAGGGAGTCTGGGTGG - Intergenic
1055505494 9:76944182-76944204 CTCACTGGAGAGAGAATGGGAGG - Intergenic
1055734738 9:79314722-79314744 GGCCCTTGAGGGAGATTGGGAGG - Intergenic
1056756887 9:89387260-89387282 CTCCCTCGAGGTGACCTGGGAGG - Intronic
1057448561 9:95136872-95136894 CTCCCTGGAGGGAGCATGAGGGG + Intronic
1060423829 9:123488280-123488302 CTCCCTGGAGGGAGTCAGGCTGG + Intronic
1060945287 9:127566848-127566870 CTTCCTCTGGGGAGACTGGGAGG + Intronic
1061113365 9:128591547-128591569 CTCCCGGGAGGCTGACTGGGCGG - Exonic
1061630115 9:131866996-131867018 CCCCATCGGGGGAGCCTGGGGGG - Intronic
1062381126 9:136287105-136287127 GTCCCTCGATGGACACTGGGTGG - Intronic
1185469781 X:375438-375460 CTGCATCGTGGGTGACTGGGCGG - Intronic
1186459220 X:9734853-9734875 CTCCCTGGAGGGAAACCGGGAGG + Intronic
1187881426 X:23851135-23851157 TTCCCTCTGGGGAGACTTGGGGG + Intronic
1194714574 X:97275275-97275297 CTCCCGGGAGGGAGGTTGGGGGG - Intronic
1196629567 X:117921835-117921857 TTCCCTAGAGGGAGAGTGGCTGG - Intronic
1198719132 X:139596209-139596231 CTCTTTCGAGTGACACTGGGTGG - Intronic