ID: 985494352

View in Genome Browser
Species Human (GRCh38)
Location 5:196433-196455
Sequence CCGTGGTGGGCGCTGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985494352_985494358 -5 Left 985494352 5:196433-196455 CCTCATGACAGCGCCCACCACGG No data
Right 985494358 5:196451-196473 CACGGGTGTGTCCCCACCCCAGG No data
985494352_985494360 -3 Left 985494352 5:196433-196455 CCTCATGACAGCGCCCACCACGG No data
Right 985494360 5:196453-196475 CGGGTGTGTCCCCACCCCAGGGG No data
985494352_985494359 -4 Left 985494352 5:196433-196455 CCTCATGACAGCGCCCACCACGG No data
Right 985494359 5:196452-196474 ACGGGTGTGTCCCCACCCCAGGG No data
985494352_985494368 20 Left 985494352 5:196433-196455 CCTCATGACAGCGCCCACCACGG No data
Right 985494368 5:196476-196498 CCCCATGTCATCCCCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985494352 Original CRISPR CCGTGGTGGGCGCTGTCATG AGG (reversed) Intergenic
No off target data available for this crispr