ID: 985497622

View in Genome Browser
Species Human (GRCh38)
Location 5:218493-218515
Sequence GGTCCGAGCGGAGCGGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 4, 1: 1, 2: 4, 3: 18, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985497612_985497622 12 Left 985497612 5:218458-218480 CCGAGGCGGCGGTAGGAGCGGGA 0: 2
1: 0
2: 1
3: 7
4: 95
Right 985497622 5:218493-218515 GGTCCGAGCGGAGCGGGCGCCGG 0: 4
1: 1
2: 4
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985497622 Original CRISPR GGTCCGAGCGGAGCGGGCGC CGG Intronic
900119098 1:1041023-1041045 GGGCGGAGCGGGGCGGGAGCGGG + Intronic
900119136 1:1041098-1041120 GGGCGGAGCGGGGCGGGAGCGGG + Intronic
900148036 1:1166838-1166860 GGGCCGAGCGGGGCGGGCAGAGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900307789 1:2019504-2019526 GGTCCGCGCGGCGCGGGGTCGGG + Intronic
900371841 1:2335701-2335723 GGTGGGAGCGGGGCGGGTGCTGG + Intronic
900626585 1:3611370-3611392 GGGCTCCGCGGAGCGGGCGCGGG - Exonic
902896658 1:19484725-19484747 GGACCGAGCGGGGCTGACGCAGG + Intronic
903907134 1:26695658-26695680 GTGGAGAGCGGAGCGGGCGCAGG - Intergenic
904245003 1:29181538-29181560 GGTCCGCGCGGAGCGGCTACCGG - Intronic
904847347 1:33430510-33430532 GGGACAAGCGGAGCAGGCGCAGG + Intronic
905183150 1:36178721-36178743 GGCCCGGGCGGAGCGGGAGGCGG + Exonic
905580641 1:39081197-39081219 GGTCAGTGAGGAGGGGGCGCCGG + Intergenic
907185013 1:52602679-52602701 CGGCCGAGCGGGGCGGGGGCCGG - Intronic
907442589 1:54488351-54488373 CGCCCGAGCGGAGCGCGCGGTGG + Intergenic
910138428 1:83999208-83999230 GTGCCGAGAGGCGCGGGCGCCGG + Intergenic
912363469 1:109113863-109113885 GGTGCGCGCGGCGTGGGCGCGGG - Intronic
912682687 1:111739164-111739186 GGTAAGAGCGAAGCTGGCGCCGG - Exonic
913009534 1:114669836-114669858 GGTGCGAGCCGAGCTGGCGGAGG - Intronic
914393495 1:147242772-147242794 GGGCCGAGCCGAGGCGGCGCGGG + Exonic
915366753 1:155321139-155321161 GTTCCGAGGGGCGAGGGCGCAGG + Intronic
915572290 1:156751248-156751270 GCTCCGCGCGGAGCGGGCAGAGG - Intronic
916048789 1:161020658-161020680 GGTGCGTGTGGAGCGCGCGCTGG + Intronic
917846616 1:179025803-179025825 GGGCCGCGCCGAGCGAGCGCTGG + Intronic
920071351 1:203305395-203305417 GGGCCGAGCGGAGCGGCTCCGGG + Intergenic
920508149 1:206531530-206531552 GGTCTGTGCGCAGAGGGCGCTGG + Intronic
922287700 1:224183824-224183846 GGGCCGAGGTGAGCGGGTGCCGG + Intronic
922503095 1:226110778-226110800 GGCCCGCGCGGCGCGGGCGGAGG + Intergenic
1065024284 10:21526234-21526256 GAGCCGAGGGGAGGGGGCGCCGG + Intergenic
1065188707 10:23192355-23192377 GGCCAGAGCGCAGCGGCCGCGGG + Exonic
1067071928 10:43138619-43138641 GGCCCGGGCGGTGCGGGCGCCGG + Intronic
1070407809 10:76112385-76112407 GGACAGAGTGGAGCCGGCGCCGG + Intronic
1070579886 10:77711300-77711322 GGAGGGACCGGAGCGGGCGCGGG + Intergenic
1071086835 10:81875266-81875288 GGGCCGCGCGGGCCGGGCGCGGG - Intergenic
1071579468 10:86756506-86756528 GGTGCGCGCGGCGCGGGCGGGGG + Intergenic
1073207315 10:101775979-101776001 GGCGCGAGCGGAGAGGGTGCGGG + Intronic
1073297621 10:102450700-102450722 GGGCCGCGTGGAGCGCGCGCGGG - Exonic
1074491851 10:113945632-113945654 GGTCAGAGGGGAGCAGGCCCTGG - Intergenic
1076644473 10:131943205-131943227 GGACAGAGAGGAGTGGGCGCTGG - Intronic
1076750094 10:132538072-132538094 TGCCCGGGCGGCGCGGGCGCTGG - Exonic
1076868917 10:133183164-133183186 GGTGCCAGCGGCGTGGGCGCGGG + Intronic
1077037976 11:504398-504420 GTCCCGGGCGGAGCGGGCGCGGG - Intronic
1077103025 11:830514-830536 GGCCCGGGCGGAGCGGGGTCGGG - Intronic
1077492698 11:2869550-2869572 CGAGCGAGCGCAGCGGGCGCGGG + Intergenic
1078053515 11:7987569-7987591 GGACCAGGCAGAGCGGGCGCTGG - Exonic
1081700054 11:45147032-45147054 GGTCCGGACGGCGCCGGCGCGGG + Intronic
1083171112 11:60924548-60924570 GGACGGCGCGGAGCGGGTGCGGG + Exonic
1084146122 11:67266348-67266370 GGGCCGAGCCGGGCGGGCGACGG - Intergenic
1084637029 11:70399090-70399112 GGTCTGAGCGGAGGGGGCCGGGG + Intronic
1084888391 11:72224685-72224707 GGGCCGAGCGGAGGGGGAGGGGG + Intronic
1085519522 11:77129955-77129977 GGGCCTAGCGGGGCGGGCCCGGG + Intronic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1092291017 12:7159450-7159472 GGCCCGAGTGGAGAGGGCGGAGG - Intergenic
1094564755 12:31590183-31590205 TGGCCGTGCGGAGCGAGCGCGGG - Intronic
1094607272 12:31959534-31959556 GGTCCGGGCGGGGCGGGGGCCGG + Intronic
1098963780 12:76764515-76764537 GGCCCGACCGGGGCGGGCTCTGG + Intronic
1099440055 12:82687675-82687697 GGGCCGAGAGGAGGGGGCGACGG + Intronic
1103085686 12:118060876-118060898 GGTCCGCGCGGGGCCGGCGGGGG - Intronic
1106665561 13:31847090-31847112 GGACCGAGGGAAGCGGGCGGGGG + Intergenic
1107935182 13:45340661-45340683 AGTCCGGGCCGAGCGGGCTCGGG - Intronic
1110860509 13:80341028-80341050 GGGCCGGGCCGGGCGGGCGCGGG + Intergenic
1111951702 13:94713230-94713252 GGCCAGAGCCGAGCCGGCGCAGG + Intergenic
1115469537 14:33754429-33754451 GGTCAGAGAGGAGAGGGAGCTGG - Intronic
1119650102 14:76377172-76377194 TATCCGAGCGGCGTGGGCGCGGG + Intronic
1119743401 14:77028109-77028131 GGCCCGAGGGGAGGGGGCGAGGG + Exonic
1122714322 14:103685040-103685062 AGTCCGAGCGGGCGGGGCGCAGG + Intronic
1123710136 15:22980607-22980629 GGTCGGAGCGGAGCGGGCGTGGG + Intronic
1124196153 15:27631700-27631722 GGTGTGAGGGGAGCGGCCGCTGG - Intergenic
1124696891 15:31870813-31870835 CGTCCGCGCGGGGCGGGGGCGGG - Intergenic
1125742055 15:41972216-41972238 GGGCGGAGCGGGGCGGGAGCCGG + Intronic
1126940402 15:53759743-53759765 GGTCCGCGCGCTGCGGGGGCAGG - Intronic
1129601120 15:76999015-76999037 TGTCTGAGCGGAGAGGGCACTGG + Intronic
1129607155 15:77030539-77030561 GGTCCGGGCTGAGTGGGAGCAGG + Exonic
1132144106 15:99416710-99416732 GGTCCGCGAGGAGTGGGCACAGG - Intergenic
1132252078 15:100341690-100341712 CGCCCGAGCGGAGGAGGCGCGGG - Intronic
1132508627 16:325314-325336 AGCCAGAGCGGAGGGGGCGCCGG - Intronic
1132719700 16:1309657-1309679 GCTGCGCGCGGAGCGGGCTCCGG + Intronic
1132815912 16:1826530-1826552 GGCTGGCGCGGAGCGGGCGCGGG - Intronic
1132815919 16:1826559-1826581 GGCTCGAGCGGAGGCGGCGCAGG - Intronic
1137267973 16:46884353-46884375 GGGCCGGGCGGCGCGGGCGCCGG + Intergenic
1138386435 16:56638572-56638594 GGACTCAGCGGGGCGGGCGCAGG + Intergenic
1138660725 16:58515635-58515657 GGAGGGAGCGGAGGGGGCGCAGG - Intronic
1139529795 16:67537533-67537555 GGTCCGCGGGGGGCGAGCGCGGG + Intronic
1139954799 16:70687958-70687980 GGCACCAGCGGAGCGGGCGTGGG - Exonic
1142058518 16:88015357-88015379 GGTCCGAGCTGAACTGGCACAGG - Intronic
1142089616 16:88203032-88203054 GGTCAAATCGGAGCGGGGGCGGG + Intergenic
1142227865 16:88886199-88886221 GGTCCGAGCAGAGGGGGCCTGGG + Intronic
1142509830 17:386259-386281 GGGCGGGGCGGGGCGGGCGCCGG - Intergenic
1143150824 17:4807022-4807044 GGGCCGAGGGCAGCGGGGGCGGG + Intergenic
1143247864 17:5500993-5501015 GGTCAGAGCGCAGTGGGCGGTGG + Intronic
1146022703 17:29293110-29293132 GCTCTGGGGGGAGCGGGCGCGGG + Intronic
1146058661 17:29593437-29593459 GGTGCGGGCGGCGCGGGCGACGG - Intronic
1147150458 17:38510924-38510946 CGGCCGAGCGGCGCGGGGGCTGG - Exonic
1147193973 17:38752941-38752963 AGTTCGAGGGGAGCGGGCCCCGG + Intronic
1148157298 17:45431583-45431605 GGTCCAAGGGGAGGGGGCGCCGG - Intronic
1148166954 17:45490480-45490502 GGTCGGAGAGGAGCGGGCGCGGG + Intronic
1148397752 17:47323879-47323901 ACCCCGAGCGGAGCGGGCCCAGG - Intronic
1149512767 17:57256672-57256694 GATCGGAGCGGAGCGGCGGCCGG - Exonic
1150388995 17:64780305-64780327 GGTCCGGGGGGAAGGGGCGCCGG - Intergenic
1150398133 17:64836884-64836906 GGTCGGAGCGGAGCGGGCGCGGG + Intergenic
1150489006 17:65561689-65561711 GGGCGGGGCGGGGCGGGCGCGGG - Intronic
1151561583 17:74872780-74872802 GGTCGGAGCAGAGCTGGGGCAGG - Intronic
1154954721 18:21242563-21242585 GGTGTGAGCGGAGCGCGTGCGGG + Intronic
1155053245 18:22165761-22165783 GGACCGCGCGGAGCCAGCGCCGG - Intergenic
1160807874 19:1000589-1000611 GGCCAGGGCGGCGCGGGCGCGGG - Exonic
1160988005 19:1848431-1848453 GGTCCGTGAGGCGCGGGCGGCGG - Exonic
1161048883 19:2151590-2151612 GGTCCCAGCCGAGCCGGCCCCGG + Intronic
1162374456 19:10296488-10296510 TGTCTGAACGGAGCGGGCGGCGG + Exonic
1163708630 19:18832390-18832412 GGCCCGGGCGGCGCGGGCGCGGG + Exonic
1164835091 19:31350796-31350818 AGCCCGAGCGGCGCGGGCGGCGG + Intergenic
1165058829 19:33195055-33195077 ACTCCGAGCGGGGCGGGAGCCGG - Intronic
1167862544 19:52297130-52297152 GGTCCGAGCGGGGCGGGGGCGGG - Intergenic
1168347143 19:55655402-55655424 GGTCCTGGCGGAGGTGGCGCGGG + Intronic
926268191 2:11344704-11344726 GGGCGGGGCGGAGCGCGCGCAGG - Intronic
927544441 2:23940435-23940457 GGTCTGCGCGGAGCCGGCGTCGG + Exonic
927698428 2:25252479-25252501 GGTCCGAGGGGCGCGGGGCCGGG + Intronic
927920745 2:26970586-26970608 AGTCCGAGCGGGGCGGGGCCAGG - Intergenic
927997284 2:27495013-27495035 GCTGCGGGCGGAGCGGGCGCGGG + Exonic
928408248 2:31031949-31031971 GTTCCGAGAGGAGAGGGAGCAGG - Intronic
931036672 2:58251668-58251690 GGACCAGGCAGAGCGGGCGCTGG - Intergenic
931253775 2:60553841-60553863 GGGCCGAGGGGAGGGGGCGCTGG + Intergenic
932681377 2:73828931-73828953 GGAGTGGGCGGAGCGGGCGCCGG + Intronic
933741719 2:85539105-85539127 GGCCCGAGCCGGGCGCGCGCGGG + Intergenic
934661313 2:96145093-96145115 GGTCCGCGGGGAGCTGGCGCGGG - Exonic
934882478 2:97995879-97995901 AGTCGGAGCGGAGAGGCCGCGGG + Exonic
935349737 2:102142840-102142862 GGGCCGGGCGGTGGGGGCGCCGG + Exonic
936556912 2:113503918-113503940 GGTCCAAGGGGCGCGGGGGCCGG + Intergenic
938222947 2:129587467-129587489 GCACCGAGCTGAGCGCGCGCTGG - Intergenic
939629682 2:144516947-144516969 GGCGCGAGCGGAGCGGGAGGCGG + Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
947119427 2:226799867-226799889 GGGCGGAGAGGGGCGGGCGCGGG - Intergenic
948115983 2:235494521-235494543 GGCGCGGGCGGAGCAGGCGCGGG - Exonic
948805870 2:240453312-240453334 GGTGGGAGCGGGGCGGGCGGTGG - Intronic
948805878 2:240453330-240453352 GGTGGGAGCGGGGCGGGCGGTGG - Intronic
948874476 2:240819599-240819621 GGCCCGAGGGGAGAGCGCGCAGG - Intronic
948874626 2:240820075-240820097 GGGGCGAGGGGCGCGGGCGCGGG + Intronic
1170890040 20:20368700-20368722 GGCGCGAGCGGAGCTGGCGGAGG + Exonic
1173891326 20:46513384-46513406 GGGCCGGGCGGAGCGGGCCTCGG - Intronic
1174606699 20:51767223-51767245 GGGCGGAGCAGAGCGGCCGCAGG + Intronic
1175814333 20:61875710-61875732 TGTCTGAGCGGAGCGGGCGCTGG - Intronic
1175847389 20:62065873-62065895 GTTCCGACTGGGGCGGGCGCTGG + Intergenic
1176005627 20:62861057-62861079 GGGCCGCGCGGCGCGGGCGGCGG + Exonic
1176026958 20:62990685-62990707 GGTCCCAGCGGGGAGTGCGCCGG + Intergenic
1176077353 20:63254496-63254518 GGAGCGGGCGGAGCGGGGGCGGG - Exonic
1176194542 20:63831194-63831216 GGTCCGAGCTGCGCGCTCGCCGG + Intronic
1176380994 21:6111874-6111896 GGTCCGGGTGGAGCGGGCGGCGG + Intronic
1178357954 21:31923925-31923947 GGGCAGGGCGGAGCGGGGGCGGG + Intronic
1179742478 21:43426366-43426388 GGTCCGGGTGGAGCGGGCGGCGG - Intronic
1181094361 22:20495637-20495659 AGTCCGAGGGGCGCGGGGGCGGG - Intronic
1183546084 22:38455440-38455462 GGGCCGAGCGCAGCGGGGCCGGG - Intergenic
1183577363 22:38700641-38700663 GGTCAGCGGCGAGCGGGCGCGGG + Exonic
1183601720 22:38843937-38843959 GGGCCGAGCGGGGCAGGCGCGGG + Exonic
1185272510 22:49935644-49935666 GGTCCGGGAGGAGCAGGGGCGGG + Intergenic
949259043 3:2083997-2084019 GGGCTGAGCAGTGCGGGCGCAGG + Intergenic
950032638 3:9862676-9862698 GGACCCAGCGGAGAGGGCTCGGG + Intergenic
950417328 3:12876056-12876078 GGACCCAGCGGAGAGGGCCCGGG + Intergenic
960955434 3:123027628-123027650 AGCCCGAGCGCAGCGGGCGCGGG - Intronic
961222705 3:125212722-125212744 GGACCGGGCGGGCCGGGCGCTGG - Intronic
967272655 3:187743921-187743943 GGCGCGGGAGGAGCGGGCGCGGG - Intronic
968051554 3:195658240-195658262 GGTCCGAGCGGAGCGGGCGCCGG + Intergenic
968104263 3:195990093-195990115 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968258164 3:197297912-197297934 GAGCCGAGCGGAGGGGGCGAAGG + Intronic
968302564 3:197627683-197627705 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968698199 4:2042699-2042721 GGTCAGGGTGGAGGGGGCGCAGG - Intronic
974875711 4:67700922-67700944 GGGCCGAGCAGAGCCGGCCCTGG - Intronic
975420493 4:74158281-74158303 GGTACGAGGGCTGCGGGCGCCGG + Exonic
975986169 4:80202882-80202904 GGTGGGGGCGGAACGGGCGCCGG + Exonic
977941992 4:102869037-102869059 GGCCAGAGCGGAGGGGGCTCGGG + Exonic
978903416 4:113979576-113979598 GCTCCGCGCGGACCGGCCGCGGG - Exonic
979530485 4:121764866-121764888 GCACCGAGCTGCGCGGGCGCTGG - Exonic
983649646 4:170026015-170026037 GATCCGTGCGGGGCGGGGGCTGG - Intronic
985497622 5:218493-218515 GGTCCGAGCGGAGCGGGCGCCGG + Intronic
1001523577 5:172413125-172413147 AGTCCCAGCGGAGCCGGAGCAGG + Intronic
1002485263 5:179530717-179530739 GGGCCGAGGGGGGCGAGCGCTGG - Intergenic
1002691443 5:181053264-181053286 GGTCCTCGCGGCGCTGGCGCTGG + Exonic
1003625213 6:7735129-7735151 GGTCAGGGTGGAGCGGGCTCCGG - Intronic
1003995888 6:11538470-11538492 GCTCCGAGCGGGGCGCGCACGGG - Intronic
1006472710 6:34237470-34237492 GGGCCGCGCGGCGCGGGGGCGGG + Intronic
1008430475 6:51410716-51410738 GGTGCGAGCTCCGCGGGCGCCGG + Intergenic
1012582060 6:100881321-100881343 GGACAGAGTGGAGCTGGCGCCGG + Exonic
1013117600 6:107114886-107114908 CGAGCGACCGGAGCGGGCGCCGG - Intronic
1017945561 6:159094081-159094103 GGTCGGAGCAGCGCGGGCGGAGG + Intergenic
1018400679 6:163415776-163415798 GGTCCGCGCAGAGCAGGCTCGGG - Intronic
1019983999 7:4641990-4642012 GGTCAGAGGTCAGCGGGCGCGGG + Intergenic
1021231081 7:18086842-18086864 GCTGCGAGCTGAGCGGGCGGCGG - Intergenic
1022097093 7:27147910-27147932 GGTCCCCGGGGAGCGGGCTCCGG - Intronic
1025089693 7:56051887-56051909 GGCCCGAGCGCAGGCGGCGCTGG + Exonic
1026890130 7:73977017-73977039 GGGCCGAGGGGAGGGAGCGCGGG + Intergenic
1026968094 7:74453239-74453261 GGTGGGAGCGGGGCGGGCGGGGG + Intergenic
1028417672 7:90596746-90596768 AGGCCGAGGGGAGCGGGCGCTGG - Intronic
1032074860 7:128831482-128831504 GGGCCGAGGGGAGCTGGCGCGGG + Intronic
1032160006 7:129502723-129502745 GGTGCTAGGGGAACGGGCGCTGG + Exonic
1034219273 7:149431689-149431711 GGCCCGAGCCCAGCGGGCGGGGG - Exonic
1035828336 8:2668330-2668352 GGTCCCAGAGGACCGGGAGCAGG + Intergenic
1049218318 8:141417753-141417775 GGGCCGCGCAGGGCGGGCGCGGG - Intronic
1049896088 9:113383-113405 GGTCCAAGGGGCGCGGGGGCCGG - Intergenic
1051206322 9:14693135-14693157 CGGCAGAGCGGAGCGGGGGCCGG + Intronic
1053034036 9:34809725-34809747 TGTCCGCCCGGAGGGGGCGCAGG - Intergenic
1053056548 9:34996391-34996413 GGGCCGAGTGGAGCGGCTGCTGG - Exonic
1056243067 9:84668720-84668742 GCTCCGGGCAGCGCGGGCGCAGG + Intronic
1056743817 9:89282795-89282817 GGGCTGAGGAGAGCGGGCGCAGG + Intergenic
1057546257 9:96021882-96021904 GTTCCGAGCGCAGCGGCTGCGGG + Intergenic
1059375273 9:113876249-113876271 GGCCTGAGCGGGGCGGGCGGAGG + Intergenic
1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG + Intergenic
1061208468 9:129177457-129177479 GGGCAGAGCGCAGCGGGCGCGGG + Exonic
1061212674 9:129202922-129202944 GGCCCGGGCGGGGCGGGCGCTGG - Intergenic
1061582340 9:131545760-131545782 GGTGCTGGCGGAGCGGGTGCTGG + Intergenic
1061856823 9:133446068-133446090 GGTCCTAGCAGAGCGGCCGGGGG + Intronic
1062022689 9:134326758-134326780 GGTCCGAGCGGGGCCCGGGCCGG - Intronic
1062504505 9:136866133-136866155 GGGCCGGGCGGGGCGGACGCTGG - Intronic
1062507762 9:136886740-136886762 AGTCCGAGCGTGGCTGGCGCGGG + Intronic
1062579226 9:137222147-137222169 GCACCGAGGGGCGCGGGCGCGGG + Intergenic
1062583944 9:137240669-137240691 GGTCCGCACGGAGCGAGCCCGGG - Intergenic
1185495905 X:554588-554610 AGTCCAAGCGGAGCTGGCTCCGG - Intergenic
1188811403 X:34657293-34657315 GAGCCGGGAGGAGCGGGCGCGGG - Intergenic
1189001996 X:36957663-36957685 GAGCGGGGCGGAGCGGGCGCGGG + Intergenic
1189534684 X:41923773-41923795 GGGCCGAGCGGCGCATGCGCGGG + Intergenic
1191830000 X:65406629-65406651 GGGCCGGGCGGGGCCGGCGCTGG + Intronic
1198807277 X:140504663-140504685 GGTGCGAGCGGAGGTGGCGGGGG - Exonic