ID: 985499349

View in Genome Browser
Species Human (GRCh38)
Location 5:231874-231896
Sequence CACTGAGAGAGCTTGTCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985499336_985499349 27 Left 985499336 5:231824-231846 CCGTGACAGAACCCCATGTGACA 0: 1
1: 0
2: 3
3: 13
4: 180
Right 985499349 5:231874-231896 CACTGAGAGAGCTTGTCGTGGGG No data
985499341_985499349 15 Left 985499341 5:231836-231858 CCCATGTGACATTGGGCGCTGGG 0: 1
1: 2
2: 1
3: 10
4: 91
Right 985499349 5:231874-231896 CACTGAGAGAGCTTGTCGTGGGG No data
985499343_985499349 14 Left 985499343 5:231837-231859 CCATGTGACATTGGGCGCTGGGC 0: 1
1: 2
2: 1
3: 10
4: 79
Right 985499349 5:231874-231896 CACTGAGAGAGCTTGTCGTGGGG No data
985499339_985499349 16 Left 985499339 5:231835-231857 CCCCATGTGACATTGGGCGCTGG 0: 1
1: 2
2: 0
3: 6
4: 75
Right 985499349 5:231874-231896 CACTGAGAGAGCTTGTCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985499349 Original CRISPR CACTGAGAGAGCTTGTCGTG GGG Intronic
No off target data available for this crispr