ID: 985502041

View in Genome Browser
Species Human (GRCh38)
Location 5:254428-254450
Sequence AGGGCTTCTTCTGTTGCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 4, 1: 0, 2: 3, 3: 27, 4: 292}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985502041_985502043 -9 Left 985502041 5:254428-254450 CCAGGGGCAACAGAAGAAGCCCT 0: 4
1: 0
2: 3
3: 27
4: 292
Right 985502043 5:254442-254464 AGAAGCCCTTTGAGGAGCACTGG 0: 3
1: 1
2: 0
3: 27
4: 193
985502041_985502048 23 Left 985502041 5:254428-254450 CCAGGGGCAACAGAAGAAGCCCT 0: 4
1: 0
2: 3
3: 27
4: 292
Right 985502048 5:254474-254496 ACCCTGTCCTATGTGGACGTTGG 0: 3
1: 0
2: 1
3: 2
4: 67
985502041_985502053 30 Left 985502041 5:254428-254450 CCAGGGGCAACAGAAGAAGCCCT 0: 4
1: 0
2: 3
3: 27
4: 292
Right 985502053 5:254481-254503 CCTATGTGGACGTTGGCACTGGG 0: 2
1: 1
2: 1
3: 2
4: 72
985502041_985502047 16 Left 985502041 5:254428-254450 CCAGGGGCAACAGAAGAAGCCCT 0: 4
1: 0
2: 3
3: 27
4: 292
Right 985502047 5:254467-254489 GAAGCACACCCTGTCCTATGTGG 0: 4
1: 0
2: 1
3: 15
4: 119
985502041_985502051 29 Left 985502041 5:254428-254450 CCAGGGGCAACAGAAGAAGCCCT 0: 4
1: 0
2: 3
3: 27
4: 292
Right 985502051 5:254480-254502 TCCTATGTGGACGTTGGCACTGG 0: 2
1: 1
2: 1
3: 2
4: 62
985502041_985502044 -6 Left 985502041 5:254428-254450 CCAGGGGCAACAGAAGAAGCCCT 0: 4
1: 0
2: 3
3: 27
4: 292
Right 985502044 5:254445-254467 AGCCCTTTGAGGAGCACTGGAGG 0: 3
1: 1
2: 1
3: 13
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985502041 Original CRISPR AGGGCTTCTTCTGTTGCCCC TGG (reversed) Exonic
900646338 1:3710355-3710377 AGGGCTTCTTTCCTTGCCCAGGG + Intronic
901396498 1:8985832-8985854 AGGTCTTGTTATGTTGCCCAAGG - Intergenic
901684750 1:10937637-10937659 AGGGCCTCTTCTGCTCCCCCTGG - Intergenic
901764231 1:11489763-11489785 GGGGCCACTTCTGCTGCCCCAGG + Intronic
901897655 1:12328390-12328412 AGGTCTTGTTTTGTTGCCCAAGG + Intronic
902316563 1:15624491-15624513 GGGTCTTACTCTGTTGCCCCAGG + Intronic
902941878 1:19806290-19806312 GGGTCTTCCTCTGTTGCCCAGGG + Intergenic
903395357 1:22997823-22997845 TGTGGTTCTTCAGTTGCCCCAGG + Intergenic
904680241 1:32223966-32223988 ATGGCTTCCTATTTTGCCCCAGG - Intronic
905577545 1:39057786-39057808 AGGCCTTCCTGTGTTGCCCAGGG + Intergenic
905702316 1:40026748-40026770 AGGTCTTACTATGTTGCCCCGGG - Intergenic
905939522 1:41852210-41852232 AGGGCTTCTGCTCTTGAGCCGGG - Intronic
908743691 1:67355087-67355109 ATGTCTTGTTCTGTTGCCCAGGG - Intronic
911921998 1:103776116-103776138 AAGGATTCTTCTCTTGCTCCAGG - Intergenic
912190926 1:107339278-107339300 AGGGCTTCTTCTGTGTTCCAGGG + Intronic
912194166 1:107378225-107378247 AGTGCTTCTGCTGCTGACCCAGG - Intronic
913711314 1:121486636-121486658 AGAGCTTCTTTTGTTTCCACTGG + Intergenic
914997868 1:152560719-152560741 AGGGTTTCTTCAGTAGACCCTGG + Intronic
915336098 1:155142967-155142989 AGGTCTTGCTCTGTTGCCCAGGG + Intergenic
915906037 1:159877846-159877868 AGGTCTTACTCTGTTGCCCAGGG - Intronic
916722808 1:167497647-167497669 AGTGCTTTTTCTGTTGTGCCAGG - Intronic
918011150 1:180587659-180587681 AGGGCTTCTTCTGTCTCCTGGGG - Intergenic
918423168 1:184384777-184384799 AGTGCTTCTTCTGTGGCCTTCGG + Intergenic
918917302 1:190659776-190659798 AGCGATTCTTCTGCTGCCTCCGG - Intergenic
920408998 1:205743390-205743412 AGGGCTTCTTTTGTTGTGCCAGG + Intronic
920793703 1:209117691-209117713 GGGTCTTGTTCTGTTGCCCAGGG + Intergenic
922509773 1:226154664-226154686 AGGGCTTCTTCTGCAGCTTCTGG + Exonic
922822147 1:228492074-228492096 AGGCCTTGCTCTGTTGGCCCAGG + Intronic
922943830 1:229493202-229493224 AGGTCTTTCTCTGTTGCCCAGGG + Intronic
924170592 1:241335751-241335773 AAGGCTTCTCCTGCAGCCCCTGG - Intronic
924642001 1:245842900-245842922 AGGTCTTCCTATGTTACCCCAGG + Intronic
1062807428 10:434303-434325 AGGTCTTGCTCTGTTGCCCAGGG + Intronic
1062997456 10:1880517-1880539 ACGGTTTATTCTGTTGCCCACGG + Intergenic
1063659566 10:8024897-8024919 GGGTCTTGTTCTGTGGCCCCAGG - Intergenic
1067061114 10:43078342-43078364 ATGGCTTCTTCTGTTCCCAAAGG - Intronic
1067581666 10:47450354-47450376 AGGGCTCATTCTGTTGCATCTGG - Intergenic
1067786534 10:49253531-49253553 AGGCCTTCTACTGTTGTACCAGG + Intergenic
1067786849 10:49256482-49256504 GGGGCTCCTGCTTTTGCCCCAGG + Intergenic
1069734960 10:70648027-70648049 AGGGCTTCCTCCTCTGCCCCAGG - Intergenic
1069898968 10:71696144-71696166 TGGGCTTCCTCAGTTTCCCCAGG - Intronic
1073112443 10:101070625-101070647 AGGGCCTCTTTTTTTCCCCCAGG + Intergenic
1073423826 10:103444273-103444295 AGTACTAGTTCTGTTGCCCCTGG + Intronic
1075567278 10:123513890-123513912 ATGGCTTTTTCTGCTGCCCTCGG + Intergenic
1076444905 10:130507630-130507652 AGGGGTCCTTCTTCTGCCCCTGG + Intergenic
1077877219 11:6319188-6319210 AGAGCTTCTTCGGCAGCCCCAGG + Exonic
1078051924 11:7972973-7972995 GAGTCTTGTTCTGTTGCCCCGGG + Intronic
1078427820 11:11265783-11265805 AGGGCTTCTGCTCTTGTCTCAGG + Intergenic
1079379434 11:19924465-19924487 AGGGCCTCTTCTGCTTCCTCTGG + Intronic
1080895910 11:36448695-36448717 AGGGCTTCTTCTCTTGGCAGAGG + Intronic
1081499262 11:43649882-43649904 AGGGCTTCTTCACTTGCCTTTGG - Intronic
1083027646 11:59564045-59564067 GGGTCTTGTTCTGTTGCCCAGGG - Intergenic
1083755182 11:64788405-64788427 TGGGCATCCTCTTTTGCCCCAGG - Intergenic
1083983953 11:66197763-66197785 AGGTCTCGTTCTGTTGCCCAGGG - Intronic
1084166473 11:67377078-67377100 GGGTCTTGCTCTGTTGCCCCAGG - Intronic
1084752619 11:71214165-71214187 GGGGCTTCCCCTGTGGCCCCAGG + Intronic
1085178212 11:74509053-74509075 AGGTCTTGTTATGTTGCCCCAGG - Intronic
1086399682 11:86450265-86450287 AGGGTTTCTTTGGTTGCTCCAGG - Intronic
1088263166 11:107964322-107964344 AGGTCTTGTTCTGTTGACCAGGG + Intergenic
1088421937 11:109657932-109657954 AGGTCTTGCTCTGCTGCCCCAGG - Intergenic
1088549314 11:110995198-110995220 AGGACTTCTTTTGTTGCTCAAGG - Intergenic
1089780592 11:120870664-120870686 AGGCATTCTTCTCTTGCCCAAGG - Intronic
1090241313 11:125183934-125183956 GGGGTTTCTTCTGTTGCCTGTGG + Intronic
1090773189 11:129939937-129939959 AAGTGTTCTGCTGTTGCCCCTGG - Intronic
1091779973 12:3207663-3207685 AGGGCTTCTCCAGTTCTCCCGGG - Intronic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1096821965 12:54243363-54243385 AGGTCTTCCTATGTTGCCCCGGG - Intronic
1096832432 12:54324879-54324901 ATCGCTTCTTCTGTTCCCCATGG + Intronic
1097833872 12:64253731-64253753 AGGTCTTGTTCTGTTCACCCAGG + Intergenic
1100257806 12:92902165-92902187 AGGTCTTACTCTGTTGCCCAGGG - Intronic
1100259071 12:92914632-92914654 AGGTCTTGTTATGTTGCCCAGGG - Intronic
1100715535 12:97301626-97301648 AGGGCCTCTGCTGTTAACCCTGG + Intergenic
1102955234 12:117054610-117054632 AGGGGTCCTTCAGCTGCCCCTGG - Intronic
1102976772 12:117212425-117212447 AGGGCTTCTTTTGGTTTCCCTGG - Exonic
1103530734 12:121599680-121599702 AAGTCTTGCTCTGTTGCCCCAGG - Intergenic
1103874909 12:124119654-124119676 TGGGCTTCTCCTGTGGCCACCGG + Intronic
1103912925 12:124362148-124362170 CGGGCTCCTGCTCTTGCCCCGGG + Exonic
1104848674 12:131860554-131860576 AGGGATCCTCCTGTGGCCCCAGG - Intergenic
1104919043 12:132281054-132281076 AGTGGTTCTTCAGTGGCCCCAGG + Intronic
1105486722 13:20840233-20840255 AGGGTCTCTTCTGTCGCCCAGGG + Intronic
1105773700 13:23637158-23637180 AGGCCTTCATCTGTGTCCCCCGG - Intronic
1107268595 13:38587423-38587445 AGGGCTTGCTATGTTGCCCAAGG + Intergenic
1108127562 13:47261143-47261165 AGGTCTTGCTCTGTTGCCCAGGG + Intergenic
1108273775 13:48787987-48788009 AGGGCATCTCCTGATGCCCTGGG + Intergenic
1109208373 13:59506488-59506510 AGGGCTGCTTCAGTTGTGCCAGG - Intergenic
1110457396 13:75705017-75705039 AGGGCTTCTTCGGAGGCCACAGG + Intronic
1113661198 13:112107473-112107495 AGGGGTGCTCCTGATGCCCCGGG + Intergenic
1114539123 14:23441962-23441984 AGGGCTTTTGCTGGTGCTCCAGG + Intergenic
1116680569 14:47964485-47964507 CAGGCTTCTTCTCTTGCTCCTGG + Intergenic
1119032082 14:71200640-71200662 AGTTCTTCTTCTGTAGCCTCAGG + Intergenic
1119575946 14:75722270-75722292 AGGTCTTGCTCTGTTGCCCAGGG + Intronic
1119935895 14:78592315-78592337 AGGGCCTCTTCTTTTGCATCAGG - Intronic
1121491562 14:94364820-94364842 AATGCTTCTTCTGTGGCACCAGG - Intergenic
1122193820 14:100069519-100069541 AGGGCTTGTTCAATTGCCTCTGG - Intronic
1125307230 15:38332544-38332566 AGGTCTTGCTCTGTTGCCCAGGG - Intronic
1125893124 15:43280637-43280659 AGAGCTTCATCTCTTGCCCATGG + Intronic
1126817881 15:52471722-52471744 GGGTCTCATTCTGTTGCCCCAGG + Intronic
1127388655 15:58487815-58487837 AGGTCATCTTGTGTTGGCCCTGG + Intronic
1128135335 15:65259111-65259133 AGGGCTTTTTCCTTTGGCCCTGG + Exonic
1128159103 15:65411350-65411372 AGGGGAGCTGCTGTTGCCCCAGG - Exonic
1128318736 15:66678117-66678139 CAGGCCTCTTCTGTGGCCCCTGG - Intronic
1129342312 15:74894107-74894129 TGGTCTCTTTCTGTTGCCCCAGG + Intronic
1129850413 15:78790600-78790622 AGGGCTTCTTCTGCAGGGCCGGG + Intronic
1129889357 15:79060887-79060909 AGGGCTTCTTCTCCTGTCACCGG + Intronic
1130266880 15:82414028-82414050 GGGTCTTTGTCTGTTGCCCCAGG + Intergenic
1130713705 15:86310720-86310742 AGGCCAGCTTCTGTGGCCCCAGG - Intronic
1134453758 16:14379203-14379225 AGGGCTCCTTCCGATGGCCCAGG - Intergenic
1135782287 16:25314199-25314221 AGGACATCCTCTGTGGCCCCAGG - Intergenic
1136175064 16:28511067-28511089 GGGGCTTCCTATGTTGCCCAGGG + Intronic
1136287551 16:29253361-29253383 AGGGCTTTCTCTGCAGCCCCAGG + Intergenic
1137268767 16:46888840-46888862 AGGTCTTCTTATGTTGCCCAGGG + Intronic
1137328189 16:47461999-47462021 AGGGCTTCTTAAGTGGCCCCAGG + Intronic
1138183167 16:54956872-54956894 CAGGCTTGCTCTGTTGCCCCAGG + Intergenic
1138894746 16:61189816-61189838 ATGGCCTCTTCTGATGCCCCTGG - Intergenic
1139153133 16:64408657-64408679 AGGTATTCCTCTGTTGACCCAGG - Intergenic
1139531921 16:67546590-67546612 ATATATTCTTCTGTTGCCCCTGG + Exonic
1140463203 16:75158244-75158266 GGGTCTTCCTCTGTTGCCCAGGG + Intronic
1141063307 16:80894864-80894886 AGGAGTCCTTCTCTTGCCCCTGG - Intergenic
1142027052 16:87820012-87820034 AGGGTCTCTCCTGCTGCCCCAGG - Intergenic
1142093171 16:88225990-88226012 AGGGCTTTCTCTGTAGCCCCAGG + Intergenic
1143218064 17:5239926-5239948 AGTGGTTCTCCTGTTGCTCCAGG - Intergenic
1143825140 17:9599614-9599636 AGGGCTGCTTCTATTTCCCCAGG - Intronic
1145245138 17:21263929-21263951 GGGGCTCCCTCTGTTCCCCCAGG - Intergenic
1147992810 17:44345424-44345446 AGCGGTTCTTCTGTTGTCTCCGG - Intronic
1152121231 17:78419962-78419984 AGGGCTTCTTCAGGACCCCCTGG - Intronic
1152328242 17:79655168-79655190 AGGGCTTTTCCTGTGGCCCCAGG - Intergenic
1153009458 18:524872-524894 AGGGCTTGCTATGTTGCCCAGGG - Intergenic
1153710105 18:7790065-7790087 GGGGCCTCTGCTGTTGCCCCAGG + Intronic
1156196558 18:34780717-34780739 AGTGCTTAGTCTGTTTCCCCAGG + Intronic
1156620522 18:38846056-38846078 AGGTCTTGCTCTGTTGCCCAGGG - Intergenic
1157841347 18:50961896-50961918 AGGTCTCCTTATGTTGCCCAAGG + Intergenic
1161997195 19:7720483-7720505 AGGTCTTGGTATGTTGCCCCAGG + Intergenic
1162304316 19:9862477-9862499 AGGTCTTGTTATGTTGCCCAGGG - Intronic
1162330914 19:10028999-10029021 AGTGGTTCTCCTGTTGCTCCAGG + Intergenic
1162542501 19:11306218-11306240 AGGTCTTGCTCTGTTGCCCAGGG + Intronic
1163814676 19:19457295-19457317 AGAGCTTCTTCCATAGCCCCAGG + Intronic
1164510003 19:28889185-28889207 AGGGCTTCTGCTGCTTCTCCTGG - Intergenic
1164873215 19:31664276-31664298 AGGTCTCACTCTGTTGCCCCAGG - Intergenic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
1165858484 19:38894300-38894322 AGGTCTTCCTCTGTTGCCCAGGG + Intronic
924988695 2:293231-293253 AGGGCCCCTGCTGCTGCCCCAGG + Intergenic
926591413 2:14743986-14744008 TATGCCTCTTCTGTTGCCCCAGG - Intergenic
926743240 2:16129374-16129396 AGGACTTCATCAGTTGTCCCTGG + Intergenic
926800121 2:16652773-16652795 AGGGCTTCTTCAGAATCCCCGGG - Intronic
927956076 2:27208213-27208235 AGGGCTTCCCCTACTGCCCCTGG + Intronic
928949202 2:36799523-36799545 AGGTCTTGCTATGTTGCCCCTGG - Intronic
930019452 2:46992587-46992609 AGGGCTTATTCTGTGAGCCCTGG + Intronic
930219641 2:48733456-48733478 AGGGCTGCTTCTGTAGCCACTGG - Intronic
930527989 2:52555271-52555293 AGTGCTCCTTCTGTTGGCACTGG + Intergenic
931068833 2:58621335-58621357 AGCCCTTCTTCAGTTGCTCCAGG + Intergenic
931347749 2:61462211-61462233 GAGTCTTGTTCTGTTGCCCCAGG - Intronic
931554892 2:63491635-63491657 AGGTCGTCTTCTACTGCCCCTGG + Intronic
931580188 2:63763473-63763495 AAGTCTTGTTCTGTTGCCCAGGG - Intronic
933827894 2:86180049-86180071 AGGTCTTGTTCTGTTGCTCCAGG - Intronic
937100370 2:119263874-119263896 AGGCCTCCTGCTGCTGCCCCAGG - Exonic
938047650 2:128137221-128137243 AGGTCTTCTCATGTTGCCCATGG - Intronic
938419859 2:131136400-131136422 GGGTCTTGTTCTGTTGCCCAGGG + Intronic
938890585 2:135701191-135701213 AGGTCTTGTTATGTTGCCCAAGG - Intronic
940356310 2:152746847-152746869 AGGTCTTGCTTTGTTGCCCCAGG + Intronic
940421101 2:153479495-153479517 AGGAGTTCTTCTGTGGCCCTTGG + Intergenic
941361175 2:164553096-164553118 AGGCATACTTCTGTTACCCCAGG - Intronic
942490142 2:176481833-176481855 AGAGTTTGTTCTGTTGCCTCAGG + Intergenic
944702226 2:202255977-202255999 AGAGATTGTTCTGTTGCCCCAGG - Intergenic
945840266 2:214879501-214879523 AGGTCCTCTGCTGTTTCCCCTGG - Intergenic
946219292 2:218212633-218212655 AGGTCTTCCTATGTTGCCCAAGG - Intergenic
946237146 2:218331011-218331033 ACGGCTTCTTCTGTTGCTGGAGG - Intronic
947572988 2:231250058-231250080 AGTCCTTTTTCTGATGCCCCAGG + Intronic
948125633 2:235563021-235563043 GGGTCTTGTTCTGTTGCCCCAGG - Intronic
948128806 2:235584986-235585008 AGTGCTGCTGCTGCTGCCCCCGG + Intronic
1169429602 20:5524867-5524889 GGGTCTTGCTCTGTTGCCCCAGG - Intergenic
1171883082 20:30632186-30632208 AGGGCTTCATCTGTGGGACCAGG - Intergenic
1173426154 20:42945428-42945450 AGGGCGTCTGCTGTTTCTCCCGG + Intronic
1176331304 21:5550799-5550821 AGGTCTTGTTCTGGTGCCCAGGG - Intergenic
1176396453 21:6270152-6270174 AGGTCTTGTTCTGGTGCCCAGGG + Intergenic
1176440704 21:6718952-6718974 AGGTCTTGTTCTGGTGCCCAGGG - Intergenic
1176464966 21:7046021-7046043 AGGTCTTGTTCTGGTGCCCAGGG - Intergenic
1176488527 21:7427800-7427822 AGGTCTTGTTCTGGTGCCCAGGG - Intergenic
1178184437 21:30203843-30203865 GGGTCTTGTTCTGTTGCGCCAGG - Intergenic
1181496519 22:23290298-23290320 AGGTCAGCTTCTGTTGTCCCGGG - Intronic
1181552779 22:23650199-23650221 AGGGACTTTTCTGTTGCCCAGGG + Intergenic
1181575896 22:23794483-23794505 AGGTCTTGCTGTGTTGCCCCAGG - Intronic
1181828684 22:25541013-25541035 GGTGCTTCTGCTGTTGCCACTGG - Intergenic
1182821892 22:33223634-33223656 AGGGCTGCTTCTGTTGAACGAGG - Intronic
1183082536 22:35465642-35465664 AGGTCTTGCTCTGTTGCCCAGGG + Intergenic
1183851130 22:40588954-40588976 AGGTCTTACTCTATTGCCCCAGG - Intronic
951578266 3:24135273-24135295 TGGGCTGCTCCTGTTGACCCTGG - Intronic
952656102 3:35787147-35787169 AGGCCTTCATCTGATGTCCCAGG + Intronic
953024036 3:39134626-39134648 AGGGCTTTTCCTGAAGCCCCAGG - Intronic
953509708 3:43523823-43523845 ATGACTTCCTCTGTAGCCCCTGG - Intronic
953509735 3:43523989-43524011 ATGGCTTCCACTGTGGCCCCTGG - Intronic
953772980 3:45792881-45792903 AGGGTTGCTTCTGTGGCCCCAGG - Intronic
953787846 3:45924048-45924070 AGGGCTTCTCCTTTAGCCCATGG - Intronic
954128810 3:48549358-48549380 GGGGCTTCCTCCCTTGCCCCAGG - Intronic
954707844 3:52490495-52490517 AGGGCTTCCTGTGCAGCCCCAGG - Intronic
954749063 3:52803666-52803688 AGGGCTTGTTCACATGCCCCAGG + Intronic
955325314 3:58005682-58005704 AGGGGATCACCTGTTGCCCCTGG - Intergenic
955349263 3:58182027-58182049 AGGTCTTGCTCTGTTGCCCAAGG - Intergenic
959364734 3:105442859-105442881 AGGTCTCCTTCTGTTGCGCATGG + Intronic
960881841 3:122353390-122353412 AGGGCTTATTCTGTTCTCTCTGG + Intergenic
960971364 3:123142299-123142321 TGGGCTTTTGCGGTTGCCCCTGG + Intronic
961728317 3:128948217-128948239 GGGTCTTGCTCTGTTGCCCCGGG + Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
963562856 3:146888396-146888418 AGAGCTTGTTCTGTCACCCCTGG + Intergenic
964985381 3:162732100-162732122 AGTGGTTCTCCTGTTGCTCCAGG - Intergenic
966402158 3:179558990-179559012 AGAATTTCTTCTGTGGCCCCAGG - Intergenic
967165395 3:186775369-186775391 GGGTCTTGTTCTGTTGCCCCCGG + Intergenic
967259769 3:187630610-187630632 AGGGCTACTTCCCTTGCCTCAGG - Intergenic
968054869 3:195683787-195683809 AGGGCTTCTTCTGTTGCCCCTGG - Intergenic
968101041 3:195965485-195965507 AGGGCTTCTTCTGTTGCCCCTGG + Intergenic
969413211 4:7042991-7043013 CGCGCGCCTTCTGTTGCCCCGGG - Intronic
971246852 4:24937095-24937117 AGGTCTGCTTCTGTTGGCCTTGG - Intronic
971607925 4:28682962-28682984 AGTGCTTCTTTTGTTCCCTCTGG - Intergenic
973366742 4:49214502-49214524 AGGGCTTCATCTGTGGGACCAGG - Intergenic
974116094 4:57580740-57580762 AGGGCTTTTTGAGTTGCTCCTGG + Intergenic
974627195 4:64440975-64440997 AGGGCTGCTTCTGTTGGGCAAGG - Intergenic
978836899 4:113161823-113161845 AGGGCCTCTTGTAATGCCCCTGG - Intronic
981324868 4:143434392-143434414 AGGGCTTGCTCTGTTGCCCATGG + Intronic
981365499 4:143897269-143897291 GGGTCTTCTTATGTTGCCCAGGG - Intronic
981564107 4:146080248-146080270 AGGTCTTGCTCTGTTGCCCCAGG + Intergenic
982724716 4:158893593-158893615 AGTGCTTCTCATATTGCCCCAGG - Exonic
985502041 5:254428-254450 AGGGCTTCTTCTGTTGCCCCTGG - Exonic
985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG + Intergenic
985920286 5:2966315-2966337 ATGCCCTTTTCTGTTGCCCCAGG + Intergenic
990252871 5:53934573-53934595 AGGCCTTCTTCTATTGCAACTGG - Intronic
990468756 5:56093963-56093985 AGGTCTCACTCTGTTGCCCCAGG - Intergenic
993115424 5:83714815-83714837 AGTGCTTCAACTGTGGCCCCTGG - Intronic
993921855 5:93815033-93815055 AGGTCTTCCTATGTTGCCCTGGG + Intronic
994448273 5:99905953-99905975 AGGTCTTGCTATGTTGCCCCAGG + Intergenic
996543000 5:124649047-124649069 AGGTCTGCTGCTGCTGCCCCGGG - Exonic
996662470 5:126020638-126020660 AGGCCTCCTTATGTTGCCCAGGG - Intergenic
996729446 5:126703255-126703277 AGTGGTTCTCCTGTTGCTCCAGG + Intergenic
997848976 5:137313843-137313865 AGGGGTTCTTCATTTCCCCCAGG - Intronic
998062141 5:139127096-139127118 AGGGCTTCTGCCATTGCCACTGG - Intronic
999168153 5:149569343-149569365 AGGTCTTACTCTGTTGACCCAGG + Intronic
1002596458 5:180327170-180327192 CGGGCTTCATCTGAAGCCCCAGG - Intronic
1003015129 6:2462090-2462112 TGTTCTTCTTCTGTTGACCCGGG + Intergenic
1003392012 6:5722581-5722603 AGGGGTTCTTCTGCTGCCCCTGG - Intronic
1004807093 6:19214413-19214435 TGTGGTTCTTCTGTTGCCTCAGG + Intergenic
1005159273 6:22839816-22839838 AGTGCTTTTTCTGTATCCCCAGG - Intergenic
1005440497 6:25862320-25862342 AGGGCTTGTGCTGTTGACCATGG + Exonic
1005533243 6:26729623-26729645 AAGCCTTCTTCTGTGGGCCCGGG + Intergenic
1005537551 6:26772041-26772063 AAGCCTTCTTCTGTGGGCCCGGG - Intergenic
1005686802 6:28260980-28261002 TGGGCTTCTTTTGGTCCCCCCGG - Intergenic
1006041643 6:31260987-31261009 AGGTCTTGCTCTGTTGCCCAGGG - Intergenic
1006161433 6:32042399-32042421 AGGGCAGGGTCTGTTGCCCCGGG - Intronic
1006359870 6:33581353-33581375 AGGTCTTGCTCTGTTGCCCAGGG - Intergenic
1006679583 6:35787472-35787494 AGGAGTTCTGCTGTGGCCCCGGG + Intronic
1008921439 6:56847291-56847313 AGGGTTTGCTCTGTTGCCCAGGG - Intronic
1009591075 6:65671941-65671963 AGGGCTGCCTCTGTTTCCACTGG - Intronic
1016829978 6:148424529-148424551 GGGGCTTGTTCTGTTTGCCCAGG + Intronic
1017129275 6:151094088-151094110 AGGGCTGCTTCTCCTACCCCAGG + Intronic
1017815519 6:158013462-158013484 GGGGCTTCCTCTGTCACCCCAGG + Intronic
1020614127 7:10437255-10437277 AGGGCCTCTACTGTAGGCCCTGG - Intergenic
1021658738 7:22897650-22897672 AGGTCTTGCTCTGTTGCCCAGGG + Intergenic
1023188070 7:37551742-37551764 AGTGCTTCTCTTGTTGCTCCAGG + Intergenic
1026197275 7:68184086-68184108 AGGTCTTCTTATGTTTCCCAGGG + Intergenic
1026651463 7:72219249-72219271 AGGTCTTGCTCTGTTGCCCAAGG + Intronic
1026742769 7:72989656-72989678 AGGGCTTCTTCGGCTTCCCAGGG - Intergenic
1026802622 7:73410046-73410068 AGGGCTTCTTCGGCTTCCCAGGG - Intergenic
1027028882 7:74874361-74874383 AGGGCTTCTTCGGCTTCCCAGGG - Intergenic
1027055589 7:75047290-75047312 AGGTCTTGTTCTGTTGCCCCCGG + Intronic
1027100966 7:75375422-75375444 AGGGCTTCTTCGGCTTCCCAGGG + Intergenic
1029144714 7:98437471-98437493 GGGTCTTCTTCTGTTCACCCCGG - Intergenic
1029252977 7:99250269-99250291 AGGACTTGTTCTGCTGCCCCAGG + Intergenic
1029269042 7:99365586-99365608 GGGTCTTGCTCTGTTGCCCCAGG - Intronic
1029359799 7:100080466-100080488 AGGTCTTGCTCTGTTGCCCCCGG - Intronic
1030991022 7:116300574-116300596 AGGGCCTCTTCTCTTGCACAGGG + Intronic
1031952420 7:127905978-127906000 GAGGCTTTTTCTGTTGCTCCTGG + Intronic
1032792777 7:135254628-135254650 AGGGCTTCTCCCCTTGTCCCAGG + Intronic
1034607344 7:152329541-152329563 AGGTCTTACTCTGTTGCCCAGGG - Intronic
1035042197 7:155937090-155937112 AGATCTTTTTCTGTTCCCCCTGG - Intergenic
1035087732 7:156275677-156275699 AGGACGTCTTCTCTTGCCCTTGG + Intergenic
1035628216 8:1089485-1089507 AGGGTCTCTCCTGCTGCCCCAGG + Intergenic
1037518498 8:19657731-19657753 AGCACTTCTTGTTTTGCCCCAGG - Intronic
1038909744 8:31949677-31949699 GGGTCATCTTCTCTTGCCCCTGG + Intronic
1038963619 8:32548480-32548502 GGGGCTGCTCCTGTCGCCCCGGG - Intronic
1039102627 8:33957489-33957511 AGGGCTTCTACTGGAGACCCAGG + Intergenic
1039780164 8:40777455-40777477 AGCCCTTTTCCTGTTGCCCCGGG + Intronic
1039835710 8:41254745-41254767 GGGTCTTGCTCTGTTGCCCCAGG - Intergenic
1042222511 8:66487274-66487296 AGGGCTTCTTCTAGTGCCTTTGG + Intronic
1043475045 8:80597858-80597880 AGGTCTTGCTCTGTTGCCCAGGG + Intergenic
1046294661 8:112201918-112201940 AGTGGTTCTCCTGTTGCTCCAGG - Intergenic
1046456148 8:114464820-114464842 AGTGTTTCTTCTGTTTCCTCAGG + Intergenic
1046620619 8:116525874-116525896 AGGTGTTCTTCTGCTGCCACTGG + Intergenic
1047211780 8:122846337-122846359 AGGTCTTATTCTCTTGCTCCTGG + Intronic
1047449805 8:124955095-124955117 AGGTCTTCCTATGTTGCCCAAGG - Intergenic
1048230134 8:132631119-132631141 TGGGCATCTTCTGTTGTGCCAGG + Intronic
1051279115 9:15423348-15423370 AGGACTTCTCCTGGTGTCCCAGG - Intronic
1053252298 9:36584909-36584931 AGGTCTTACTCTGTTGCCCAGGG + Intronic
1056007198 9:82285275-82285297 AGGACTCCCTTTGTTGCCCCAGG - Intergenic
1056812040 9:89772416-89772438 AGGCCTTCTACCCTTGCCCCTGG - Intergenic
1057959028 9:99437331-99437353 GGGGATTTTCCTGTTGCCCCAGG + Intergenic
1058285657 9:103174731-103174753 AGTGCTTCTACTGGTGCACCAGG - Intergenic
1058485086 9:105435628-105435650 AGTGGTTCTCCTGTTGCTCCAGG + Intronic
1058980300 9:110162727-110162749 AGGTCTTACTCTGTTGCCCAGGG + Intronic
1059191145 9:112327532-112327554 TGGTCTCCCTCTGTTGCCCCAGG - Intronic
1059375613 9:113878730-113878752 AGGGTTTCCTTTCTTGCCCCAGG - Intronic
1059440204 9:114302264-114302286 AGGGCTCGTTCTGTTGCTTCCGG - Intronic
1060565917 9:124591521-124591543 ACTGCTGCTTCTGTTGCCTCTGG - Intronic
1060772328 9:126341587-126341609 AGGGCTTCTTCTGCTGGACCAGG - Intronic
1061327574 9:129873633-129873655 AGGGCTGCTTCCCTGGCCCCTGG + Intronic
1061672011 9:132194148-132194170 AGTGCTGCTTCTGCTGCCCCTGG - Intronic
1061906222 9:133700298-133700320 GGGTCTTGCTCTGTTGCCCCAGG - Intronic
1062196930 9:135279589-135279611 AGAGCTGCGTCTGTGGCCCCGGG + Intergenic
1062400078 9:136368510-136368532 GGGGCTTCCTTTGTAGCCCCAGG + Intronic
1062550282 9:137082933-137082955 AGGGCCTCTCCTGTCGCCTCTGG + Exonic
1203430798 Un_GL000195v1:89528-89550 AGGTCTTGTTCTGGTGCCCAGGG + Intergenic
1185628804 X:1501383-1501405 AGGTCTTGCTCTGTTGCCCCAGG + Intronic
1188107701 X:26163814-26163836 AGGGCTTCTACTGGTGCCCCAGG + Intergenic
1188111090 X:26197037-26197059 AAGGCTTCTACTGGTGCCCCAGG + Intergenic
1188881428 X:35496788-35496810 AGTGGTTCTCCTGTTGCTCCAGG - Intergenic
1189586091 X:42463487-42463509 AGGGCTCCACCTGTGGCCCCTGG + Intergenic
1190724720 X:53181403-53181425 AGGGCTGCTTCTGCTGCCAGGGG - Intergenic
1192144248 X:68670451-68670473 AGGGCTTCTTTTGTGGCCTAAGG + Intronic
1193150077 X:78115874-78115896 GGGTCTTGTTCTGTTGCCCATGG + Intronic
1194936593 X:99957223-99957245 ATGACTTCTTCCCTTGCCCCTGG - Intergenic
1196421514 X:115527020-115527042 GGGTCTTCCTCTGTTGCCCAAGG + Intergenic
1196620110 X:117812080-117812102 AATGTTTATTCTGTTGCCCCTGG - Intergenic
1196871998 X:120121193-120121215 AGGGCTTATTCTCTTTCCCCAGG + Intergenic
1197196226 X:123703862-123703884 AGAGTTTCCTCTGTTGCCCAGGG - Intronic
1197719830 X:129737796-129737818 GGGTCTTATTCTGTTGCCCAGGG - Intergenic
1199166629 X:144683454-144683476 AAGGCCTTTTCTTTTGCCCCTGG + Intergenic
1199253883 X:145696720-145696742 TGGGCTTCTTTTGTTGTACCAGG - Intergenic
1199528880 X:148824842-148824864 GGGTCTCCTTTTGTTGCCCCAGG - Intronic
1200110277 X:153737407-153737429 AGCCCTGCCTCTGTTGCCCCAGG - Intronic
1202364802 Y:24151771-24151793 GGGTCTTTCTCTGTTGCCCCAGG + Intergenic
1202505979 Y:25518351-25518373 GGGTCTTTCTCTGTTGCCCCAGG - Intergenic