ID: 985502086

View in Genome Browser
Species Human (GRCh38)
Location 5:254654-254676
Sequence CTCCGACAGCAGTCGGGCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 1, 2: 2, 3: 2, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985502078_985502086 27 Left 985502078 5:254604-254626 CCAGATTTAAATCAACTCCCGAC 0: 3
1: 1
2: 0
3: 1
4: 47
Right 985502086 5:254654-254676 CTCCGACAGCAGTCGGGCTTCGG 0: 1
1: 1
2: 2
3: 2
4: 49
985502081_985502086 9 Left 985502081 5:254622-254644 CCGACAGATTCGAGGCACCGCTG 0: 1
1: 3
2: 0
3: 6
4: 40
Right 985502086 5:254654-254676 CTCCGACAGCAGTCGGGCTTCGG 0: 1
1: 1
2: 2
3: 2
4: 49
985502080_985502086 10 Left 985502080 5:254621-254643 CCCGACAGATTCGAGGCACCGCT 0: 1
1: 3
2: 0
3: 0
4: 33
Right 985502086 5:254654-254676 CTCCGACAGCAGTCGGGCTTCGG 0: 1
1: 1
2: 2
3: 2
4: 49
985502083_985502086 -8 Left 985502083 5:254639-254661 CCGCTGAAAAAGGCACTCCGACA 0: 1
1: 3
2: 0
3: 8
4: 69
Right 985502086 5:254654-254676 CTCCGACAGCAGTCGGGCTTCGG 0: 1
1: 1
2: 2
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985502086 Original CRISPR CTCCGACAGCAGTCGGGCTT CGG Intronic
920534614 1:206729494-206729516 CCCCCACAGCACTCGGGCTCAGG - Intronic
922905026 1:229167733-229167755 CTCCGACAACAGCAGGGCTAGGG + Intergenic
1063371376 10:5525006-5525028 CTGGGACAGCAGCCGGGCTGCGG + Exonic
1070726694 10:78796734-78796756 CTCCAACAGCAGGAGTGCTTGGG + Intergenic
1077251745 11:1563793-1563815 CTCCGCCAGCAGTGGGGCTGGGG - Intronic
1078100272 11:8326238-8326260 CTCCTACAGCAATCGGACCTGGG + Intergenic
1078759549 11:14241496-14241518 CCCCGACACCAGTCAGGCTGAGG - Intronic
1084170309 11:67397722-67397744 GTCCCACAGCGGTCGGGCCTGGG + Exonic
1094424347 12:30302902-30302924 CTCTGCCGGCAGTCAGGCTTGGG + Intergenic
1099555114 12:84101087-84101109 TTCCCGCAACAGTCGGGCTTTGG - Intergenic
1113617865 13:111693877-111693899 CTCCGTCAGCAGTCAGCCTGGGG + Intergenic
1113623398 13:111779138-111779160 CTCCGTCAGCAGTCAGCCTGGGG + Intergenic
1114673987 14:24429265-24429287 CAGTGACAGCAGTTGGGCTTTGG + Exonic
1115891724 14:38037818-38037840 CTCCTTCAGCAGCAGGGCTTTGG + Intronic
1132195708 15:99913301-99913323 CTCCCACAGCTGTCGGCCTTAGG - Intergenic
1141851641 16:86650197-86650219 CTCCCACAGCTGCTGGGCTTTGG + Intergenic
1142070074 16:88087049-88087071 CTCCCCCAGCAGCCGGGCTGTGG + Intronic
1145815694 17:27793597-27793619 CGCGGGCAGCAGTCAGGCTTCGG + Intronic
1147427285 17:40351948-40351970 CTCTCAGAGCACTCGGGCTTGGG - Exonic
1148214382 17:45826479-45826501 CTCCCTGAGCAGTCGGGCCTGGG - Intronic
1154013459 18:10595384-10595406 CTCCTGCAGCAGTAGGGTTTGGG + Intergenic
1154152684 18:11918979-11919001 CTCCTGCAGCAGTAGGGTTTGGG + Intergenic
1157410656 18:47460266-47460288 CTCTGAGTGCAGTGGGGCTTGGG + Intergenic
1162241763 19:9360984-9361006 CTCTGACTGCAGTCAGGTTTGGG - Intronic
1165858910 19:38896699-38896721 CTCTGACAGTGGTCGTGCTTTGG + Intronic
942936141 2:181558596-181558618 CTCTGACAGGAGTCAGGATTCGG + Exonic
1181041176 22:20193347-20193369 CTGAGCCAGGAGTCGGGCTTGGG + Intergenic
1185217117 22:49607678-49607700 CTACGACAGAAGTGGGACTTGGG - Intronic
952682671 3:36112877-36112899 CTCTGACAACAGTGGGGCCTCGG - Intergenic
960313195 3:116142166-116142188 CTCCTACAGCAGGCGGGTGTGGG - Intronic
962351115 3:134656406-134656428 CACCCACAGCAGACTGGCTTTGG - Intronic
968054912 3:195684013-195684035 CTCTGACAGCAGTCGGGCTTCGG + Intergenic
968100999 3:195965259-195965281 CTCTGACAGCAGTTGGGCTTCGG - Intergenic
985502086 5:254654-254676 CTCCGACAGCAGTCGGGCTTCGG + Intronic
985734932 5:1574012-1574034 CTCTGACAGCAGTTGGGCTTTGG - Intergenic
990402383 5:55451894-55451916 CTCTAACAGCAGAAGGGCTTGGG - Intronic
992492998 5:77263666-77263688 CTCCGACATCAGTTGGGCAAGGG - Intronic
998126715 5:139628722-139628744 CTCCGACTGCACTCCAGCTTAGG - Intergenic
998887206 5:146706785-146706807 CGCCAACCGCAGTCGGGCTGAGG - Intronic
1006410946 6:33872909-33872931 CTCGGAAAGCAGTGGGGCTGGGG - Intergenic
1008441015 6:51531898-51531920 CTCCCAAAGCAGGAGGGCTTGGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1015631890 6:135239458-135239480 CTCCCAAAGCAGTCAGGCATTGG + Intergenic
1015708686 6:136115833-136115855 CTCAGACAGCAGTGGGACTGGGG + Intronic
1015986830 6:138893052-138893074 CTACCACAGCAGTAGGGCTCTGG - Intronic
1018926347 6:168209522-168209544 CTCCGAGAGCAGTGGGGCCAGGG - Intergenic
1035559735 8:595234-595256 CTCCTACAGCTGTTGGGCCTTGG + Intergenic
1042175970 8:66037156-66037178 CCTCAACAGCAGTGGGGCTTTGG + Intronic
1047499240 8:125429662-125429684 CTCCGGCTGCAGCCGGGCCTCGG + Intergenic
1053072983 9:35111809-35111831 CTCCGGCAGCTGTCGGGTTAAGG - Intronic
1061321024 9:129829484-129829506 CTCTGCCAGCAGACGGGCCTTGG + Exonic
1192017868 X:67351215-67351237 CTCTAACAGCAGTAGGGCCTAGG - Intergenic
1196736091 X:118982090-118982112 TTCCCAGAGCAGTTGGGCTTGGG + Intronic
1197904643 X:131412172-131412194 CTCTAACAGCACTCGGGCTGGGG + Intergenic
1201637733 Y:16143965-16143987 CTGCCACTGCAGTCTGGCTTGGG + Intergenic