ID: 985503425

View in Genome Browser
Species Human (GRCh38)
Location 5:263362-263384
Sequence TGGGGGCCTCAGCACTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985503418_985503425 23 Left 985503418 5:263316-263338 CCAGAGAACAACACATCACACAC No data
Right 985503425 5:263362-263384 TGGGGGCCTCAGCACTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985503425 Original CRISPR TGGGGGCCTCAGCACTAGGA AGG Intergenic
No off target data available for this crispr