ID: 985504615

View in Genome Browser
Species Human (GRCh38)
Location 5:271850-271872
Sequence CGGGGCCGCCGCGGCGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1344
Summary {0: 1, 1: 1, 2: 8, 3: 167, 4: 1167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985504615_985504631 19 Left 985504615 5:271850-271872 CCGCCTCCGCCGCGGCGGCCCCG 0: 1
1: 1
2: 8
3: 167
4: 1167
Right 985504631 5:271892-271914 CGACCAACCCCGTTCCCTGCCGG 0: 1
1: 4
2: 0
3: 2
4: 58
985504615_985504636 30 Left 985504615 5:271850-271872 CCGCCTCCGCCGCGGCGGCCCCG 0: 1
1: 1
2: 8
3: 167
4: 1167
Right 985504636 5:271903-271925 GTTCCCTGCCGGTTCTACTGCGG 0: 1
1: 0
2: 1
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985504615 Original CRISPR CGGGGCCGCCGCGGCGGAGG CGG (reversed) Intronic
900113610 1:1019774-1019796 CCGGGGGGCCGCGGCGGGGGAGG + Intergenic
900237611 1:1600158-1600180 CGGACCCGGCGCGGCGGCGGAGG + Intergenic
900240545 1:1615464-1615486 CGGGGGCGCTCCGGCGGGGGCGG + Exonic
900255035 1:1693441-1693463 CGGGGCCGCCGCGCGGGGTGAGG + Intronic
900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG + Intergenic
900414672 1:2529505-2529527 CGCGGCGGCGGCGGCGGCGGTGG + Exonic
900463604 1:2813143-2813165 AGTGGCCGCCGAGGCCGAGGAGG - Intergenic
900512976 1:3069054-3069076 CGAGGCGGCGGCGGCGGCGGCGG + Intergenic
901002280 1:6154768-6154790 CGCGGCAGCAGCGGCGGCGGCGG - Exonic
901045469 1:6393307-6393329 GGGGGCTGCGGCGGCGGATGCGG + Intronic
901056025 1:6448971-6448993 AGGGGCGGCGGCGGCGGTGGGGG - Exonic
901641342 1:10694603-10694625 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
902072298 1:13749920-13749942 CGGGCCCGCCGCGCAGGACGCGG + Intronic
902263795 1:15247161-15247183 CGTGGCCTGCGCGGCAGAGGGGG - Intergenic
902286198 1:15410064-15410086 CGGGGCAGCGGCGGCGGCGGCGG + Exonic
902323651 1:15684508-15684530 CGGGGCGGCGGCGGCGGTGGCGG + Exonic
902336814 1:15758821-15758843 CGGAGCCGCCGGGGCGCGGGCGG + Intronic
902451503 1:16499353-16499375 CGGGGCCGAGGCGGGGGCGGGGG + Intergenic
902478331 1:16699524-16699546 AGGGGCGGCGGCGGCGGCGGCGG + Intergenic
902690573 1:18108081-18108103 CGGGGCGGCGGGGGTGGAGGCGG - Exonic
902916699 1:19644141-19644163 AGGGGGCGCCGCGGCGGCAGGGG - Intronic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903115633 1:21176588-21176610 GGCGGCGGCGGCGGCGGAGGCGG - Intronic
903233873 1:21937351-21937373 CGGGGCCGGCGCTGCGGGGGCGG - Intergenic
903263427 1:22143137-22143159 GGCGGCGGCGGCGGCGGAGGCGG + Intronic
903324743 1:22563452-22563474 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
903398295 1:23019614-23019636 GGCGGCAGCCGCGGCGGCGGCGG + Exonic
903652372 1:24929939-24929961 CGCGGCAGCGGCGGCCGAGGAGG - Intronic
903777062 1:25800146-25800168 CGGGGCGGCCGGGGCGGGGAGGG - Intergenic
903907300 1:26696201-26696223 CGGGCTGGCGGCGGCGGAGGAGG - Exonic
904659285 1:32072846-32072868 AGGGGCCGCCCGGACGGAGGCGG - Intronic
904782933 1:32964394-32964416 GGAGGCCGCGGCGGCGGCGGCGG - Exonic
904822828 1:33256454-33256476 CGAGGCGGCGGCGGCGGCGGCGG - Intergenic
905137121 1:35808338-35808360 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
905179267 1:36156372-36156394 CGGGGTCTCAGCGGCGGCGGCGG - Exonic
905414380 1:37794387-37794409 CGGGGCGGCGGCGGCGGCGGGGG - Exonic
905449284 1:38046641-38046663 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
905449289 1:38046650-38046672 CCCGGACGCCGCGGCGGCGGCGG - Exonic
905449306 1:38046694-38046716 CGGGGCCCCGGTGGCGGAGCCGG - Exonic
905553133 1:38859718-38859740 GGTGGCGGCGGCGGCGGAGGCGG - Exonic
906055981 1:42917209-42917231 CGGGCCAGCAGCTGCGGAGGGGG - Intergenic
906204396 1:43979336-43979358 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
906480948 1:46198468-46198490 CGCGGCAGCGGCGGCGGCGGCGG - Intronic
906551301 1:46668343-46668365 CGAGGCCGACGCGCCTGAGGAGG - Exonic
906719992 1:47997427-47997449 TGGGGCCGCTGGGGCGGGGGAGG + Intergenic
907962520 1:59296763-59296785 AGGGGCCGCGCCGGCGGGGGCGG + Intronic
908293107 1:62687938-62687960 CCGGGCCGCCGAGGAGCAGGAGG + Intronic
908401134 1:63774061-63774083 CGGGGCTCCCTCGGCGGCGGCGG - Exonic
908473810 1:64470108-64470130 CTGGGCCGCCGCGGCGGCTGCGG - Intergenic
908527582 1:65002686-65002708 CTGGCCGGCGGCGGCGGAGGCGG + Intergenic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
910277557 1:85465061-85465083 AGGGGCGGCGGCGGCGGCGGAGG + Exonic
910277558 1:85465064-85465086 GGCGGCGGCGGCGGCGGAGGCGG + Exonic
910981305 1:92961764-92961786 AGGGGGCGCCGCGGCAGCGGGGG + Intergenic
911027181 1:93448088-93448110 CGGGGACGCGTCGGCGGCGGAGG + Intergenic
911133824 1:94418423-94418445 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
911133826 1:94418429-94418451 AGGGGACGCGGCGGCGGCGGCGG - Intergenic
911527543 1:99004755-99004777 CGGGGGCGCGGCGGCGGAGGCGG + Exonic
912305202 1:108560105-108560127 GGCGGCAGCGGCGGCGGAGGCGG + Exonic
912927899 1:113929703-113929725 CGGGGCTGAGGCGGCGGCGGCGG + Exonic
912993450 1:114510974-114510996 CGGGCCCGCCGCGCAGGAGGCGG - Exonic
913565558 1:120069421-120069443 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
913630081 1:120701091-120701113 CTGGGCAGCAGCGGCCGAGGAGG - Intergenic
913632573 1:120724135-120724157 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
914134151 1:144883865-144883887 GGGGGAAGCCGCGGCGGCGGGGG + Intergenic
914134191 1:144883962-144883984 GGGGGAAGCCGCGGCGGCGGGGG + Intergenic
914286154 1:146228793-146228815 CGCGGCGGCGGCGGCGGAGGAGG - Exonic
914286157 1:146228799-146228821 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
914286158 1:146228802-146228824 CCAGGCGGCCGCGGCGGCGGCGG - Exonic
914547185 1:148679546-148679568 CCAGGCGGCGGCGGCGGAGGAGG - Intronic
914560007 1:148808681-148808703 CTGGGCAGCAGCGGCCGAGGAGG + Intronic
914612826 1:149321534-149321556 CTGGGCAGCAGCGGCCGAGGAGG - Intergenic
914619323 1:149390815-149390837 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
915200052 1:154220722-154220744 CAGGGCCGCCGTGAAGGAGGCGG + Intronic
915213340 1:154325584-154325606 CGGGGCCGCAGCTGGGGGGGCGG + Intronic
915246347 1:154558627-154558649 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
915246398 1:154558766-154558788 CGGGGCCGCCTAGGAGGAGGAGG - Intronic
915912969 1:159925545-159925567 CGGGTCCGCCCCGTCTGAGGCGG - Intronic
916065504 1:161132640-161132662 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
916065507 1:161132646-161132668 CACGGCCGCGGCGGCGGCGGCGG - Exonic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
916233346 1:162561658-162561680 GGGGGCCGCGGCGGCGGGGCGGG - Exonic
916750914 1:167722110-167722132 CAGGGACGCGGCGGCGGCGGCGG + Exonic
917214021 1:172659364-172659386 GGTGGCGGCGGCGGCGGAGGTGG - Exonic
917846669 1:179025958-179025980 CGGAGCCGCTGTGGCGGCGGCGG + Exonic
917974436 1:180230017-180230039 TGAGGCCGGCGGGGCGGAGGGGG - Intergenic
918542696 1:185649147-185649169 CGGGCCAGCAGCTGCGGAGGGGG - Intergenic
919463239 1:197902935-197902957 CGGGGCGGCCGCGGCGGGGCGGG - Intronic
919892001 1:201982575-201982597 CGGGGCCCGCGCGGCGGGGGCGG + Intronic
919916966 1:202144764-202144786 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
920309963 1:205043230-205043252 GGCGGCCGCGGCGGCGGTGGCGG - Exonic
920309964 1:205043233-205043255 GGCGGCGGCCGCGGCGGCGGTGG - Exonic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
920528457 1:206685201-206685223 CGGGGACGCCGGGGCACAGGCGG - Exonic
921432793 1:215083001-215083023 CGTGGCGGCGGCGGCGGCGGCGG + Intronic
924289726 1:242524716-242524738 CGGGGCGGCGGCGGCGGCGGGGG + Intergenic
924436559 1:244048611-244048633 GGGGGCGGGCGCGGGGGAGGGGG - Intergenic
924754785 1:246931491-246931513 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1062774716 10:135522-135544 CGCGGCGGCGGCGGCGGTGGAGG + Intronic
1062932680 10:1363283-1363305 CGGGGCCGCGGGGGTGGCGGGGG + Exonic
1063130440 10:3172977-3172999 CGGGGCCGACGTGCCGAAGGAGG + Intergenic
1063663653 10:8049719-8049741 AGGGGCCGAGGCGGAGGAGGGGG + Intergenic
1063995138 10:11611691-11611713 CGGGGCCGGAGGCGCGGAGGCGG - Intronic
1064230783 10:13528447-13528469 AGCGGCCGCCGGGGCGGCGGGGG - Intronic
1064230921 10:13528881-13528903 CCGGGGCGCGGCGGCGGCGGCGG + Intronic
1064230923 10:13528887-13528909 CGCGGCGGCGGCGGCGGAGGCGG + Intronic
1064354283 10:14603989-14604011 GGGGGGCGCCGCGGAGGCGGGGG - Intronic
1064443173 10:15371243-15371265 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1065186525 10:23174607-23174629 CGAGGCCGGCGGGGCGGGGGCGG - Intergenic
1065214942 10:23439720-23439742 CGGGCCGGCGGCGGCGGAGGCGG - Exonic
1065342976 10:24723680-24723702 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1065590375 10:27256800-27256822 CGGGGCGGGAGCGGGGGAGGGGG - Intergenic
1065727263 10:28677869-28677891 CGGGGGCGCCGCGGCCGTGCGGG + Exonic
1066022573 10:31318833-31318855 CCGGGCAGCCGCGGCGGGTGTGG + Intronic
1066429341 10:35336882-35336904 CGGGTCAGCAGCGGCGGCGGCGG - Exonic
1066994754 10:42553215-42553237 TGGTGCCGCCGCGGCGCAGCGGG - Intergenic
1069761802 10:70816233-70816255 CGGGGCGGCTGCGGCCGGGGCGG + Intronic
1069769518 10:70888467-70888489 CGGGGCAGCCGCGGGCGAGGTGG - Intronic
1069819271 10:71217541-71217563 CGGGGGCGCAGCGGCTGAGGCGG - Intronic
1070304954 10:75234473-75234495 CGGGGCCGGAGCCCCGGAGGGGG + Intronic
1070327859 10:75399867-75399889 CGGGGGCGCCTCGGCCGAAGGGG - Exonic
1070328206 10:75401349-75401371 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
1070570783 10:77638175-77638197 CAGGGGCGCCCGGGCGGAGGGGG - Intronic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1070877387 10:79826381-79826403 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1070947960 10:80408692-80408714 GGGGCCTGCCGCGGCGTAGGTGG + Intronic
1071527463 10:86366640-86366662 CCAGGCCGGCGCGGCGGGGGCGG + Intergenic
1071618175 10:87094977-87094999 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
1071690877 10:87818292-87818314 CGCGGTCGCCGGCGCGGAGGGGG + Intronic
1072562184 10:96586703-96586725 CGGGGCGGCCGCGCCGGCCGGGG + Intronic
1072562229 10:96586890-96586912 GGAGGCGGCGGCGGCGGAGGAGG - Exonic
1072562235 10:96586905-96586927 CGAATCGGCCGCGGCGGAGGCGG - Exonic
1072673141 10:97446265-97446287 CCGGGGCGCCGAGTCGGAGGGGG + Exonic
1072713953 10:97737149-97737171 GGTGGCGGCCGCGGCGTAGGCGG + Exonic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1073099601 10:100999787-100999809 GGGCGCCGCGGAGGCGGAGGCGG + Exonic
1073111790 10:101066940-101066962 CGGGTCCGCTGCAGCAGAGGCGG - Intronic
1073266367 10:102230673-102230695 GGCGGCAGCCGCGGCGGCGGCGG + Exonic
1074169719 10:110919951-110919973 CGGGCCTGCGGCGGCGGCGGCGG + Intronic
1074503358 10:114045010-114045032 CGGGGCGGTGGCGGCGGCGGCGG - Exonic
1074814505 10:117134311-117134333 CGGGGCGGCGGCGGCGGCTGCGG + Exonic
1074829860 10:117240950-117240972 AGGCGCGGCCGCGGCCGAGGCGG + Intergenic
1074923806 10:118046784-118046806 CGCGGCCGCCCCGGCGCCGGCGG + Intergenic
1075629317 10:123991684-123991706 CGGGGCGGTGGCGGCGGCGGCGG + Intergenic
1075629319 10:123991690-123991712 GGTGGCGGCGGCGGCGGAGGAGG + Intergenic
1075885482 10:125896188-125896210 CGGGGCCCCGGCGGCGGAAGGGG - Intronic
1076035515 10:127196183-127196205 CGGGCCGGCAGCGGTGGAGGGGG - Intronic
1076035632 10:127196591-127196613 CGGGCCCCGCGGGGCGGAGGTGG + Intronic
1076554345 10:131311922-131311944 CCGGGCGGCCGCGGAGGACGTGG + Intergenic
1076722082 10:132397153-132397175 CGGGGCTGACCCGGCGGCGGCGG + Exonic
1076985976 11:236364-236386 CGGGGCCGGGGCGCCGGGGGCGG - Exonic
1077049651 11:560960-560982 CGGGTGCGCCGCGGCGCTGGGGG + Intronic
1077063420 11:627305-627327 GGGCGCCAGCGCGGCGGAGGGGG - Intergenic
1077063645 11:628237-628259 CCAGGCCGCGGCGGCGAAGGCGG - Intergenic
1077065537 11:639560-639582 CGGGGGCGCCGGGGCGCGGGCGG - Intronic
1077074673 11:694963-694985 CGCGGCCGCTGTGGCGGCGGCGG - Exonic
1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG + Intergenic
1077269136 11:1666853-1666875 CGGGGCCTCCCGGGCGGTGGGGG - Intergenic
1077271411 11:1683861-1683883 CGGGGCCTCCCGGGCGGTGGGGG + Intergenic
1077309872 11:1883527-1883549 GGGGGCCGCAGGGGCTGAGGAGG + Exonic
1077674966 11:4187447-4187469 TGCGGCGGCCGCGGCGGCGGCGG + Intergenic
1077889792 11:6410864-6410886 CGGGGAGGCCGAGGAGGAGGAGG - Exonic
1078180136 11:9004241-9004263 CGGGGCCCCCACGCAGGAGGGGG - Intergenic
1078210288 11:9265044-9265066 AGTGGCGGCGGCGGCGGAGGGGG - Exonic
1079035187 11:17014414-17014436 CGGAGCCGCCGCGGGGTGGGGGG + Intronic
1080606633 11:33869625-33869647 CGGGCGCGCCGCGGCCGAGGCGG + Intronic
1081705635 11:45180798-45180820 CGGGGCGGCCACGGGGCAGGGGG + Intronic
1081709996 11:45210342-45210364 CAGGGCCCCAGCGGCCGAGGCGG + Intronic
1081861018 11:46333329-46333351 CCGGGCAGCCGAGGAGGAGGTGG + Intronic
1082821226 11:57545975-57545997 CGGGGCCCCCGGGGCCGAGCAGG - Exonic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1083430683 11:62612475-62612497 CCGAGCGGCGGCGGCGGAGGAGG + Exonic
1083571586 11:63764446-63764468 CGGGCCCGCAGAGGAGGAGGAGG - Exonic
1083595547 11:63916960-63916982 CGGGGCACCGGCGGCGGCGGCGG + Intergenic
1083743465 11:64722934-64722956 GGGGGGCGCTGCGGCGGAGACGG - Intronic
1083904826 11:65662767-65662789 CGGGGCCGCCGCGGCTGTGGCGG - Intronic
1083992832 11:66257610-66257632 CGGGGCCATCGAGGCGGGGGCGG - Intronic
1084000176 11:66291853-66291875 CGCGGCGGCAGCGGCGGCGGCGG - Exonic
1084028441 11:66467029-66467051 TGAGGCCGCCGGGGCGGAGGGGG + Intronic
1084072388 11:66744817-66744839 GGGGGCGGCGGCGGCGGCGGCGG + Intronic
1084225367 11:67711803-67711825 TGGGGACGGCGCGGAGGAGGAGG - Intergenic
1084263183 11:67991650-67991672 TGGGGACGGCGCGGAGGAGGAGG - Exonic
1084284178 11:68120984-68121006 AGCGGCAGCGGCGGCGGAGGGGG + Exonic
1084284261 11:68121310-68121332 CGGGGCGGCGGCGGCGGCTGCGG + Intronic
1084810214 11:71607471-71607493 TGGGGACGGCGCGGAGGAGGAGG + Intergenic
1085044010 11:73343099-73343121 CGGGGGCGCCGGGGTGGCGGCGG - Intronic
1086322441 11:85664746-85664768 CCGGGCTGCAGCGGGGGAGGAGG - Exonic
1087014625 11:93543241-93543263 CGGCGCGGCGGCGGCGGCGGCGG - Intronic
1087163439 11:94973687-94973709 CGGGGCCGAAGCGGCCCAGGGGG + Exonic
1087175194 11:95089762-95089784 CGGGGCGGCCCGGGCGGCGGGGG - Intergenic
1087672751 11:101127544-101127566 GGGGGCCGCCCCGGCGGCGGCGG + Exonic
1087761746 11:102110379-102110401 CGGGGCCGCGGCGGCGCGGGCGG + Intergenic
1088172848 11:107017873-107017895 CGGGGCCGGGGCGGCGGCAGCGG + Exonic
1088172898 11:107018064-107018086 CGGAGCTGCAGCGGCCGAGGCGG + Exonic
1088810199 11:113387140-113387162 CGGGGTGGCCACGGGGGAGGTGG - Intergenic
1088935989 11:114400674-114400696 GGGGGCGGCGGCGGCGGAAGCGG + Exonic
1089432712 11:118436689-118436711 TGTGGCGGCCGCGGCGGCGGCGG + Exonic
1089432713 11:118436692-118436714 GGCGGCCGCGGCGGCGGCGGCGG + Exonic
1089564444 11:119363606-119363628 CGGGGCCACCGAGAGGGAGGGGG + Intronic
1089584560 11:119502261-119502283 CGGGGCTGCTGCTGCGGATGGGG + Intergenic
1090238283 11:125165150-125165172 CGAGGCGGCGGCGGCGGCGGCGG - Intronic
1090768252 11:129895594-129895616 CTGGGCCTGCGCGGCGGAAGGGG + Intergenic
1090780266 11:130001882-130001904 CGGGGCTGGCCGGGCGGAGGCGG - Intronic
1090799179 11:130159992-130160014 CGGGCCCGCAAGGGCGGAGGGGG + Exonic
1091222066 11:133935627-133935649 CAGGTACGCCGAGGCGGAGGGGG + Exonic
1091306791 11:134541519-134541541 CGGGGCCCTCTCGGCCGAGGTGG - Intergenic
1091550042 12:1530259-1530281 CGGGGCCGGCGCGGCTGTCGGGG + Intronic
1091550288 12:1530983-1531005 CGGGGCGGCGGCGGCGGCGGCGG - Intronic
1091558581 12:1594164-1594186 CGAGGCGGCGGCGGCGGCGGCGG - Exonic
1091616229 12:2053049-2053071 CGGGCCCGGAGCGGCGGCGGCGG + Intronic
1091740767 12:2959261-2959283 CCGGGCCGCCGGGGCGGGGCGGG - Intergenic
1091823168 12:3491300-3491322 CGAAGCCTCCGCGGCGGCGGCGG - Exonic
1092297210 12:7210071-7210093 CGGGGCCCCCGGGGTGAAGGAGG + Exonic
1092335419 12:7628732-7628754 AGGGGCGGCGGCGGCGGCGGCGG - Intergenic
1092518438 12:9240409-9240431 GGAGTCCGCGGCGGCGGAGGCGG + Intergenic
1092784044 12:12011742-12011764 TGGGGCGGCCGGGGCGGGGGAGG + Intergenic
1092796045 12:12111063-12111085 GGAGTCCGCGGCGGCGGAGGAGG - Intronic
1093465065 12:19440192-19440214 CGGGGCAGCCAGGGCGGCGGCGG + Exonic
1093547930 12:20369563-20369585 GGAGGCGGCGGCGGCGGAGGAGG + Exonic
1093715433 12:22376757-22376779 AGGGGGCGCCGAGGCCGAGGAGG - Intronic
1093958792 12:25250904-25250926 GGCGGCGGCCGCGGCGGCGGAGG - Intronic
1094041108 12:26122614-26122636 GGGGGGCGGCGCGGCGGCGGCGG - Exonic
1094107847 12:26832845-26832867 GGGAGCCGCCGCGGCAGAAGCGG + Exonic
1094375403 12:29783756-29783778 CAGGGCAGCAGCGGCGGCGGCGG - Exonic
1094652478 12:32391191-32391213 AGCGGACGCCGAGGCGGAGGAGG + Intergenic
1095432020 12:42144662-42144684 CGCGGCGGCGGCGGCGAAGGAGG - Exonic
1095432022 12:42144671-42144693 CGGGGCGGGCGCGGCGGCGGCGG - Exonic
1096078223 12:48818023-48818045 CGGGGACGCTGCGGCAAAGGCGG - Intronic
1096178749 12:49539354-49539376 CGGGGACTCCGCGCCGGGGGAGG - Exonic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096482455 12:51951707-51951729 CTGGGCTGCGGCGGCGGCGGCGG + Exonic
1096700612 12:53380466-53380488 CGGGGCCTCCGAGGAGGAGGGGG + Intronic
1096716211 12:53493051-53493073 GGGGGCCGCGGCGGCGGAAGGGG + Intronic
1096983735 12:55743391-55743413 CGAGGGCCCCGCGGCGGCGGCGG + Exonic
1096983741 12:55743400-55743422 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1097234148 12:57528309-57528331 CGGGGCCGGAGGGGAGGAGGGGG + Exonic
1097284238 12:57865382-57865404 CGGGGCCGGCGCTCCGGCGGGGG - Intergenic
1098105960 12:67069306-67069328 CCGGGCGGCGGCGGCGGCGGCGG + Intergenic
1098161043 12:67648657-67648679 GGGGCCTGCGGCGGCGGAGGAGG + Intronic
1098275686 12:68808790-68808812 CGGGGCCGCTTCGGCGCGGGAGG + Intronic
1099202063 12:79689882-79689904 CGGTGCAGCCGAGGCAGAGGCGG + Exonic
1099228155 12:79993444-79993466 CGGGCCAGCAGCTGCGGAGGGGG - Intergenic
1100611399 12:96194351-96194373 CGGGGCCGGGGCGGCGGGGGAGG + Intergenic
1101592722 12:106138626-106138648 AGGGGCCGCCGCGCCTGTGGCGG - Exonic
1101605878 12:106247579-106247601 GGCGGCAGCGGCGGCGGAGGCGG + Exonic
1101605884 12:106247622-106247644 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1101605889 12:106247631-106247653 GGCGGCCACCGCGGCGGCGGCGG - Exonic
1101606007 12:106248042-106248064 CGGGGTCGGCGCCGCGGCGGCGG - Intronic
1101970690 12:109309961-109309983 GGTGGCGGCGGCGGCGGAGGCGG + Intergenic
1102278359 12:111599398-111599420 AGCGGCCGGCGCGGCGGAGCGGG - Exonic
1102370947 12:112382089-112382111 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1102370950 12:112382095-112382117 GGCGGCCGCGGCGGCGGCGGCGG - Intronic
1103363937 12:120369117-120369139 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
1103521320 12:121538150-121538172 CGGGGCCGCCAGGGAGGCGGAGG + Intronic
1103563599 12:121804679-121804701 CGTCTCCGCCGCGGCGGCGGCGG - Intronic
1103604865 12:122078978-122079000 CGGGGTGGCCGCGCCGGAGGCGG - Exonic
1103719666 12:122966495-122966517 CGGGGCCTCAGTGACGGAGGGGG + Intronic
1103749867 12:123151153-123151175 CGGGGGAGCGGCGGCGGCGGCGG + Intergenic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1103807473 12:123584562-123584584 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1103954252 12:124567589-124567611 CCCGGCGGCCGCGGCGGCGGTGG + Intronic
1103954254 12:124567592-124567614 GGCGGCCGCGGCGGCGGTGGCGG + Intergenic
1104049559 12:125186483-125186505 AGGAGCCGCGGCGGCGGCGGCGG + Intergenic
1104049564 12:125186489-125186511 CGCGGCGGCGGCGGCGGCGGGGG + Intergenic
1104373880 12:128247383-128247405 CGGGCCAGCAGCTGCGGAGGGGG + Intergenic
1104929085 12:132328938-132328960 CGGGGGCGCCGGGGCGGAGTGGG - Intronic
1104957745 12:132474670-132474692 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957755 12:132474693-132474715 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957765 12:132474716-132474738 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957774 12:132474739-132474761 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957783 12:132474762-132474784 GGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957794 12:132474786-132474808 TGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957804 12:132474809-132474831 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957813 12:132474832-132474854 GGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957824 12:132474856-132474878 TGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957834 12:132474879-132474901 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957843 12:132474902-132474924 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957853 12:132474925-132474947 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957882 12:132474991-132475013 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957892 12:132475015-132475037 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957921 12:132475082-132475104 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957930 12:132475105-132475127 TGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957940 12:132475128-132475150 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957960 12:132475173-132475195 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957969 12:132475196-132475218 TGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957979 12:132475219-132475241 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104958066 12:132475410-132475432 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1105217472 13:18297562-18297584 AGGGGGCGCCGCGGCGGCGCTGG + Intergenic
1105249113 13:18680602-18680624 GGGGGCCCCCGAGGAGGAGGAGG + Intergenic
1105472072 13:20703738-20703760 CGGGGCGGCGGCGGCGGCGGGGG + Intronic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1106208404 13:27620499-27620521 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1106512391 13:30422372-30422394 CCTGGCCGCGGCGGCGGTGGTGG + Intergenic
1106516954 13:30464703-30464725 CGCGGCGGCGGCGGCGCAGGCGG - Intronic
1107624842 13:42272045-42272067 CGGAGCTGCGGCGGCGGCGGCGG + Intergenic
1107770969 13:43787138-43787160 CGGGGCGGCAGCAGAGGAGGAGG + Intergenic
1107851499 13:44576828-44576850 CCGGGGCGCGGCGGCGGCGGTGG + Intronic
1107978683 13:45714030-45714052 CGGGCCCTCCGGGGAGGAGGAGG + Exonic
1108227456 13:48303944-48303966 CGCGGCGGCAGCGGCGGCGGTGG - Exonic
1108435347 13:50396735-50396757 CGGGCCAGCGGCTGCGGAGGGGG + Intronic
1110596587 13:77326784-77326806 CGAGGCGGCGGCGGCGGCGGCGG - Intronic
1110596589 13:77326790-77326812 CGGGGACGAGGCGGCGGCGGCGG - Intronic
1111199960 13:84922605-84922627 CGGGGGGGCCGGGGCGGGGGCGG - Intergenic
1112088209 13:96053535-96053557 CGGAGCCGCCGGGGCGGCGCCGG + Intergenic
1112091874 13:96091076-96091098 GGGGGCCCCCGGGGCGGCGGGGG - Exonic
1112091898 13:96091111-96091133 GGGGGCCGCGGCGCCGGAGGAGG + Exonic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1113157550 13:107341039-107341061 CGGGGCGGCGGGGGCGGTGGGGG - Intronic
1113378817 13:109785571-109785593 CGCGGCGGGCGCGGCGGCGGGGG + Exonic
1113494151 13:110714388-110714410 GAGGGCCGCCGCTGCGGAGCCGG - Intronic
1113541865 13:111115432-111115454 CGAGGCGGCGGCGGCGGCGGCGG + Exonic
1113643685 13:111976610-111976632 CGGAGCCGGCGAGGCGGAGGTGG + Intergenic
1113655929 13:112067764-112067786 GGGGGCGGCGGCGGCGGCGGGGG + Exonic
1113656116 13:112068546-112068568 CGTGGCGGCGGCGGCGGCGGCGG + Exonic
1113779757 13:112969278-112969300 CGGAGGGGGCGCGGCGGAGGCGG - Exonic
1113794736 13:113050656-113050678 GGGGGCCGGGGCGGTGGAGGGGG + Intronic
1113841263 13:113363087-113363109 CTGGGGCGCCCCGGAGGAGGGGG + Intronic
1113914855 13:113864029-113864051 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1114259284 14:21025548-21025570 CGGGACCGCCGCTGAGGAGGCGG + Intronic
1114485166 14:23057650-23057672 CCGGGCCCGCGCGGCGGGGGCGG + Intergenic
1114516172 14:23301637-23301659 CGGGGCCGGACCGGCGTAGGCGG + Exonic
1115028144 14:28766478-28766500 CGGAGCCGGCGGGGTGGAGGGGG + Intergenic
1115320826 14:32077388-32077410 CGGGGCCGCTGCCGTTGAGGAGG + Exonic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1115399234 14:32939122-32939144 CGTGGCGGCGGCGGCGGCGGCGG - Intronic
1115399237 14:32939128-32939150 CGTGGCCGTGGCGGCGGCGGCGG - Intronic
1115399320 14:32939420-32939442 GGGGCCCTCGGCGGCGGAGGCGG - Intronic
1115906681 14:38209441-38209463 CCGGGCAGCTGCGGCGAAGGCGG + Exonic
1117253600 14:53956867-53956889 AGGGGCCGCCGGGGAAGAGGAGG - Intronic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1118289202 14:64504516-64504538 GGGGGCCGTCGCGGCGGCGGCGG - Intronic
1118351001 14:64972368-64972390 CGGGGCGGCGGCGGCGGCGCAGG - Intronic
1118849474 14:69573074-69573096 CGGGGCCGAGGCCGCGGCGGCGG + Exonic
1118849477 14:69573080-69573102 CGAGGCCGCGGCGGCGGCGGCGG + Exonic
1118849480 14:69573086-69573108 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1118971548 14:70642067-70642089 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1118992439 14:70809069-70809091 CGGGGCCGAGGAGGAGGAGGAGG - Exonic
1119035606 14:71228098-71228120 AGGGGCAGCCGGGGCTGAGGAGG + Intergenic
1119500894 14:75126780-75126802 CGGCGGCGGCGCGGCGGAGCAGG - Exonic
1121050441 14:90816334-90816356 GGGCGCCGCGGCGGCGGCGGTGG - Exonic
1121050442 14:90816337-90816359 AGGGGGCGCCGCGGCGGCGGCGG - Exonic
1121145378 14:91578097-91578119 CGGGCCAGCAGCTGCGGAGGGGG + Intergenic
1121355063 14:93207248-93207270 CGGCTCGGCCCCGGCGGAGGCGG - Exonic
1122162297 14:99793302-99793324 CGCGGCTGCGGCGGCGGCGGCGG + Intronic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122221034 14:100239208-100239230 CGAGGCCGCCGCGGCCGTGGCGG + Exonic
1122221236 14:100240063-100240085 CGGGGGCGCGGCGGCGGCGGCGG + Intronic
1122264100 14:100538674-100538696 CGGGGCCGCCACCGCGGCCGTGG + Exonic
1122445016 14:101761779-101761801 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
1122445046 14:101761859-101761881 AGGGGCGGCGGCGGCGGCGGCGG + Exonic
1122486760 14:102087140-102087162 CGCGGCCGCGGCGGCGGCTGGGG - Intronic
1122523438 14:102363067-102363089 CGGCCCCGCCGGGCCGGAGGAGG - Exonic
1122558291 14:102592957-102592979 GGAGGCGGCGGCGGCGGAGGCGG - Exonic
1122558321 14:102593059-102593081 GGGGGCGGCGGCGGCTGAGGCGG - Exonic
1122658472 14:103278998-103279020 CGGAGCCGGGGCGGAGGAGGCGG - Intergenic
1122917486 14:104865668-104865690 CAGGGCCGCCTCCGCGGCGGCGG - Intronic
1122947700 14:105020783-105020805 CGGGGTGGCCGCTGCTGAGGGGG - Intronic
1122975251 14:105168327-105168349 CGGGGCGGCGGGGGCGGCGGGGG - Intronic
1123025060 14:105420315-105420337 GGGGGCGGCCGCGGGGGTGGCGG + Intronic
1123036684 14:105474611-105474633 CGGGCCCCTCGCGCCGGAGGTGG - Intronic
1202872576 14_GL000225v1_random:177729-177751 CTGGGCCCCGGCGGCGGAAGGGG + Intergenic
1123396644 15:19944001-19944023 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1124109480 15:26773042-26773064 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1124109484 15:26773051-26773073 CCGGGCCAGCGCGGCGGCGGCGG - Exonic
1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG + Intronic
1124652507 15:31484005-31484027 CGTGGCGGCGGCGGCGGCGGCGG + Exonic
1124971128 15:34490502-34490524 CGGGGCGGCGGGGGCGGCGGCGG - Intergenic
1125508787 15:40282026-40282048 CCGGGCCGCAGCGGCGGCGGCGG + Exonic
1125522937 15:40358258-40358280 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1126113284 15:45187755-45187777 GGGGGGGGCGGCGGCGGAGGGGG - Intronic
1126467688 15:48975924-48975946 CGGGGCGGCCGCGGAGCTGGCGG - Intergenic
1126736661 15:51737677-51737699 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
1126800778 15:52295291-52295313 CGAGGCCGGAGCGGCGGAGGGGG + Intronic
1126849870 15:52790370-52790392 GCGGGCCGCTGCGGCGGCGGCGG - Intronic
1126852397 15:52805377-52805399 CGAGGCGGCGGCGGCGGCGGCGG + Intergenic
1127144085 15:56007193-56007215 CCGGGCGGCGGCGGCGGCGGTGG + Intergenic
1127165778 15:56243819-56243841 AGCGGCGGCCGCGGCGGCGGCGG - Intergenic
1127414947 15:58749227-58749249 CGGGGCCGCCAGGGCGGTGGGGG + Intronic
1127515520 15:59689388-59689410 CGGGGGCGTGGCGGCGGCGGAGG + Exonic
1127606507 15:60592469-60592491 CGGCGCGGCGGCGGCAGAGGGGG - Intronic
1128028577 15:64460591-64460613 CGCGGCGGCGGCGGCGGTGGCGG + Intergenic
1128056474 15:64703237-64703259 CGGGGCGGCGGCGGCGGCGGCGG - Exonic
1128056476 15:64703243-64703265 CGGGGGCGGGGCGGCGGCGGCGG - Exonic
1128067850 15:64775583-64775605 CGAGTGCGCCGCGGCGGCGGCGG + Exonic
1128115426 15:65102163-65102185 CGGGGGCGACGCGGGGGCGGCGG + Exonic
1128161004 15:65422881-65422903 CGGGGAGGCGGCGGCGGCGGCGG - Exonic
1128181718 15:65610970-65610992 CGGGGCGGCCGCCACGGTGGCGG + Intronic
1128582401 15:68818955-68818977 GGGGGCGGCCGCGGGAGAGGAGG - Intronic
1129333178 15:74838170-74838192 CGGAGCCCCCGGGCCGGAGGCGG - Exonic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1129986357 15:79923091-79923113 CGGGGACGCCCCGGTGGCGGAGG - Intronic
1130076578 15:80695241-80695263 CGGGGCCGGCCCGGCGGGCGCGG - Intronic
1130076690 15:80695617-80695639 CTGGGCCGCGGCGGCGGCGGCGG - Exonic
1130362962 15:83207686-83207708 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1130564421 15:84981686-84981708 CGGGGAGGCGGCGGCGGCGGCGG + Intronic
1131094809 15:89648489-89648511 CATGGCGGCCGCCGCGGAGGCGG + Exonic
1131094810 15:89648492-89648514 GGCGGCCGCCGCGGAGGCGGTGG + Exonic
1131515342 15:93073131-93073153 CCGGGCGCCCGCGGCCGAGGTGG - Intronic
1131694134 15:94856626-94856648 CGGAGCTGGCGCGGCGGCGGAGG + Intergenic
1132163634 15:99565330-99565352 CGGGGCTCCCGGGGCGGGGGCGG - Intergenic
1132368657 15:101277420-101277442 CTGGGCGGCGGCGGCGGCGGCGG - Exonic
1132583170 16:694496-694518 CGGGTCCGAGGCGGAGGAGGAGG - Intronic
1132641969 16:982078-982100 CCGGGGCGACCCGGCGGAGGCGG + Exonic
1132683471 16:1153060-1153082 CGGGGCCGGCGCGACCGGGGCGG - Intergenic
1132734721 16:1379697-1379719 CGGGGCCAGCGCGGAGGGGGCGG - Intronic
1132885098 16:2179030-2179052 GGGGGGCGCGGCGGCGGCGGCGG + Exonic
1132885100 16:2179036-2179058 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1133021603 16:2969362-2969384 CGCGGCGGCGGCGGCGGCGGTGG - Exonic
1133156560 16:3880452-3880474 TGGGGGGGCCGCGGCGGCGGCGG - Exonic
1133232099 16:4371784-4371806 CGGGCCCGCCGCGGCAGGGGCGG - Intronic
1133784353 16:8963359-8963381 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1134143604 16:11742758-11742780 CGGGCCCGAGGCGGCGGCGGCGG - Exonic
1134615763 16:15650249-15650271 CGCGGCGGCGGCGGCAGAGGCGG - Intronic
1134615766 16:15650258-15650280 CGAGGCCAACGCGGCGGCGGCGG - Intronic
1135023800 16:18983993-18984015 CGGGGAGGCGGCGGCGGCGGCGG + Exonic
1135480077 16:22814641-22814663 CGCGCCCTCCGCGGCTGAGGTGG - Exonic
1135691320 16:24539914-24539936 CGAGGCGGCGGCGGCGGCGGGGG + Intronic
1135821862 16:25692299-25692321 CTGGGCAGCGGCGGCGGCGGCGG + Exonic
1135821883 16:25692381-25692403 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1136365174 16:29806408-29806430 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1136512707 16:30748786-30748808 GGGGGCCTGCGCGGAGGAGGAGG - Exonic
1136550487 16:30980002-30980024 CGGGGCGGTGGCGGCGGGGGTGG - Exonic
1137244695 16:46692872-46692894 CGGGGCGGCGGTGGCGGTGGGGG + Intronic
1137267960 16:46884316-46884338 CGGGGCGGCCCCGACGGTGGTGG + Intergenic
1137280310 16:46971466-46971488 CGGGAAGGCAGCGGCGGAGGTGG - Exonic
1137617263 16:49855506-49855528 GGCGGCGGCGGCGGCGGAGGGGG - Intronic
1138328076 16:56191777-56191799 GGAGGCGGCGGCGGCGGAGGAGG - Intronic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1138478291 16:57284720-57284742 GGGGGCGGCCCCGGCGGCGGGGG - Intergenic
1138655243 16:58487698-58487720 CGGGGACGCCCGGGCGGAGAAGG - Intronic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1139637120 16:68264516-68264538 CTGAGCTGCCGCGGCGGCGGCGG + Intronic
1139664508 16:68447084-68447106 GGGGGGCGCGGCCGCGGAGGGGG - Intronic
1139761414 16:69187322-69187344 CGACGCCGCCGCGGCCGAGCTGG + Exonic
1140097078 16:71884219-71884241 CCTGGCCGGCGCGGGGGAGGGGG - Intronic
1140209182 16:72957814-72957836 CGGGGCGGCGGCGGCGGCGGTGG - Exonic
1140927569 16:79599173-79599195 CGGGGGCGCGGCGGGGGCGGGGG - Exonic
1140927582 16:79599196-79599218 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
1140927586 16:79599208-79599230 GGGGGCGGCGGCGGCGGCGGCGG - Exonic
1140927764 16:79599916-79599938 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1141054498 16:80803663-80803685 CGGGGGCGCGGGGGAGGAGGGGG - Intronic
1141054615 16:80804016-80804038 CGAGCCCGCGGCGGCGGCGGCGG - Intronic
1141079203 16:81035956-81035978 CGGGCCCGAGGCGGCGGCGGCGG - Exonic
1141608586 16:85169266-85169288 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1141665295 16:85462686-85462708 CGGGGGCGCCGCGGCGCGGGAGG + Intergenic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141840130 16:86568577-86568599 CGGGGCCGCCGCGGCGCAGGCGG + Exonic
1141972359 16:87492479-87492501 CGGGGCGGCCGGGGCGGCCGGGG + Intergenic
1142136237 16:88453203-88453225 CGGGGCCGGAGCGCCGGGGGCGG + Intergenic
1142136282 16:88453352-88453374 CCGAGCGGCCGCGGCGGCGGCGG + Exonic
1142163331 16:88570620-88570642 GGAGGCCGCCGAGGCGGCGGCGG + Intronic
1142188595 16:88706576-88706598 CTGGGCCGCGGCGCCGGGGGCGG - Exonic
1142611010 17:1109234-1109256 CGAGGCGGCGGCGGCGGCGGCGG - Intronic
1142764330 17:2057108-2057130 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1142836795 17:2593588-2593610 TGGGGCGGCGGCGGCGGCGGCGG + Intronic
1143116487 17:4584453-4584475 CGGGGCCTCGGGGGCGGAGCCGG - Intronic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1143590886 17:7885329-7885351 CGGGGTGGCGGCGGCGGCGGCGG - Intronic
1144021163 17:11241065-11241087 CCGGGCGGCGGCGGCGGCGGCGG - Intergenic
1144527243 17:16000176-16000198 CGGGGCCGCTGCCGAGGACGGGG + Exonic
1144682599 17:17205623-17205645 CGGTGCCTCCGCGGTGGGGGCGG - Intronic
1144724543 17:17495264-17495286 CGGGCCGGCAGCGGCGGCGGCGG - Exonic
1144786897 17:17837010-17837032 CTGGGCGGTCGAGGCGGAGGCGG + Intergenic
1145276049 17:21431438-21431460 CAGGGCCACCGCTGAGGAGGAGG - Intergenic
1145313895 17:21717352-21717374 CAGGGCCACCGCTGAGGAGGAGG - Intergenic
1145327270 17:21842670-21842692 AGAAGCCGCCGCGGCGGGGGGGG - Intergenic
1145694211 17:26774525-26774547 AGGGGCGGCGGCGGCGGCGGCGG - Intergenic
1146187283 17:30732037-30732059 CGGTAACGCCGCGGAGGAGGAGG - Intergenic
1146229539 17:31095447-31095469 TGAGGCAGCCGCGGGGGAGGCGG - Intronic
1146322790 17:31859356-31859378 CGGGGGCGGGGCGGCGCAGGGGG + Intergenic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146332335 17:31937416-31937438 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1146398654 17:32487290-32487312 GGGGACCGCAGCGGCGGCGGCGG + Intronic
1147132886 17:38419352-38419374 CGGGGCCGGCGCGGCGAGGACGG + Intergenic
1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG + Intronic
1147161770 17:38572772-38572794 GGCGGCCGCGGCTGCGGAGGCGG - Intronic
1147161813 17:38572929-38572951 CGGGGCCGCGCCGAGGGAGGGGG - Intronic
1147168702 17:38606046-38606068 CGGGGCGGCGGGGGCGGGGGAGG + Intergenic
1147400403 17:40177500-40177522 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1147719825 17:42532206-42532228 CTGGGCGGCGGCGGCGGCGGCGG - Intergenic
1147740795 17:42670102-42670124 CGGGCCCGGCGCGGCGGGGCCGG - Exonic
1148054968 17:44788489-44788511 AGGGGCCGACGCTGCTGAGGGGG - Intergenic
1148126936 17:45241984-45242006 CCGGGCAGCGGCGGCGCAGGCGG - Exonic
1148166941 17:45490447-45490469 CGGGGCCACAGCGGCGGTGCAGG + Intronic
1148437165 17:47693964-47693986 CGGAGCAGCCGGGGAGGAGGAGG + Intergenic
1148437175 17:47693991-47694013 GGAGGCGGCGGCGGCGGAGGAGG + Intergenic
1148502318 17:48101211-48101233 AGGGGGCGCGGCGGCGGCGGCGG - Intronic
1148664079 17:49361855-49361877 CGGGGGCGCCGCCGCGGCGGTGG + Intronic
1148664097 17:49361918-49361940 CGGGGCGGCGGAGGCGGAGGCGG - Intronic
1148664100 17:49361924-49361946 GGCGGCCGGGGCGGCGGAGGCGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148899554 17:50865988-50866010 CCGGGCCCAGGCGGCGGAGGAGG - Intronic
1149772310 17:59331685-59331707 AGTGGCGGCCGCGGCGGTGGCGG + Exonic
1149994705 17:61400353-61400375 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1149994706 17:61400356-61400378 GGCGGCCGCGGCGGCGGCGGCGG + Exonic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150060590 17:62065380-62065402 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1150373667 17:64662376-64662398 CGGGGCCGGCGGGGCGGGGCGGG + Intergenic
1150398120 17:64836851-64836873 CGGGGCCACAGCGGCGGTGCAGG + Intergenic
1150423172 17:65056604-65056626 GGGGCCCGCCGAGGCGGCGGCGG - Exonic
1150791967 17:68205971-68205993 GGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1151309710 17:73285721-73285743 AGGGGCCGCCACGGCGTACGGGG + Exonic
1151370874 17:73645331-73645353 AGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1151472316 17:74326084-74326106 GGGGGCCTCCTCGGCGGAGGCGG + Intergenic
1152353637 17:79796796-79796818 CGCGGCCGTGGCGGCGGCGGCGG - Intronic
1152362667 17:79839713-79839735 TGTGTCCGCCGGGGCGGAGGCGG + Intergenic
1152552315 17:81035701-81035723 CAGGGCCGGGGCGGCGGGGGCGG + Intronic
1152651979 17:81499089-81499111 CGGTGCCGCAGCGACAGAGGGGG + Intergenic
1152697497 17:81804314-81804336 CGGGGCGGGCGCGGCGGGGCCGG + Intronic
1152711225 17:81871256-81871278 CGGAGGCGGCGGGGCGGAGGCGG - Intronic
1152721882 17:81927473-81927495 TGGGGGCGGCGCGGCGGGGGCGG - Intronic
1152730688 17:81968134-81968156 AGGGGCGGCGGCGGCGGGGGCGG + Intergenic
1152782105 17:82231177-82231199 CGGGGCCCACCCGGGGGAGGGGG - Intronic
1152808790 17:82371617-82371639 CGGGGCCGCAGCGGGGTCGGCGG - Intergenic
1152908503 17:82983740-82983762 CAGGGGCCCCGGGGCGGAGGAGG + Intronic
1153040817 18:812016-812038 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1153794402 18:8609494-8609516 GGCGGCGGCAGCGGCGGAGGAGG + Exonic
1153805310 18:8705332-8705354 CGGTGCCGCGGCGGCGCTGGCGG - Intergenic
1153900605 18:9614495-9614517 CCGGGCGGCCGCGGAGGAGGGGG - Exonic
1154214872 18:12408311-12408333 GGGGGCGGCCGGGGCGGGGGCGG + Intronic
1154268211 18:12897116-12897138 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1154268214 18:12897122-12897144 TGGTGCCGCGGCGGCGGCGGCGG - Intronic
1154439772 18:14378628-14378650 GGGGGCCCCCGAGGAGGAGGAGG - Intergenic
1154503666 18:15010462-15010484 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155075219 18:22348640-22348662 CGGGGCCGCCCAGCCGGAGCCGG - Intergenic
1155152795 18:23135878-23135900 CTGGGCCGGCGCGGCGGCCGCGG - Exonic
1155199350 18:23503588-23503610 CGGGGCCCCCGCCGCGGGCGCGG + Exonic
1155654340 18:28177067-28177089 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1156099748 18:33578746-33578768 CCGGTCCGCGGCGGCGGAGACGG + Intronic
1156213840 18:34976944-34976966 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1156243038 18:35271866-35271888 CGGGCCAGCAGCTGCGGAGGGGG - Intronic
1156275697 18:35581400-35581422 TGGGCTCGCCGCAGCGGAGGGGG + Intronic
1156275780 18:35581677-35581699 GGGGGCGGGCGCGGCGGAGCGGG + Intronic
1156275818 18:35581801-35581823 CGGGCCGGCCGCGGCGGTCGCGG - Intronic
1157383935 18:47247076-47247098 GGGGGCGGCGGCGGCGGCGGCGG + Intronic
1157384319 18:47248373-47248395 CGTGGCCGCCGCGGCCGCGGTGG - Intronic
1157473773 18:48008570-48008592 CGGGCCGGCGGCGGAGGAGGAGG - Intergenic
1157763463 18:50281458-50281480 GGAGGCGGCCGCGGAGGAGGAGG - Exonic
1157867053 18:51196768-51196790 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
1157867054 18:51196771-51196793 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1158601939 18:58863506-58863528 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1158954698 18:62526614-62526636 CGGGTGCGCGGCGGCGGCGGCGG - Intronic
1159102347 18:63970619-63970641 AGGAGCCGCCGCTGCGGAGGAGG + Intronic
1160163208 18:76491268-76491290 CGGGGCCGGGGCCGGGGAGGGGG - Intronic
1160453597 18:78980676-78980698 GGGGGGCGGCGCGGCGGCGGAGG - Intronic
1160592423 18:79951782-79951804 CGGGGCTGTCGGGGCGGTGGGGG + Intergenic
1160631172 18:80247247-80247269 CAGGGCCGCCGGGGCGGGCGGGG + Intronic
1160680309 19:409076-409098 CGGGGCTGGCGCGGGGGACGCGG + Exonic
1160738809 19:676604-676626 GGGGGGCGCGGCGGCGGCGGCGG + Intronic
1160763561 19:797558-797580 GGAGGCCGGCGCGGCGGCGGGGG - Intronic
1160861283 19:1238105-1238127 CTCGGCCGCCGCGGCGGGTGCGG - Intergenic
1160873173 19:1286089-1286111 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
1160910346 19:1471077-1471099 CGGCGCAGCCGCGGCGGGCGAGG + Exonic
1160930466 19:1567640-1567662 CGGGGCGGCGGCGGCGGCGGGGG + Exonic
1160930514 19:1567788-1567810 CGGGGACGGCGCAGCGGCGGCGG - Exonic
1160991781 19:1863168-1863190 CGGGGACGAGGCGGCTGAGGAGG + Exonic
1161015100 19:1979454-1979476 CGGGGCCTCGGCGGGGGTGGGGG - Intronic
1161022141 19:2015539-2015561 AGGGGCGGCGGCGGCGGCGGCGG + Exonic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161050981 19:2164030-2164052 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1161106092 19:2444791-2444813 GGGGGCCGCAGCAGAGGAGGAGG - Intronic
1161207201 19:3047269-3047291 CGGGGCGGCCGCGGCGGGGAGGG + Intronic
1161264622 19:3358662-3358684 CGAGGCCTCCGCAGCGGAGGAGG - Intergenic
1161264780 19:3359285-3359307 CGCGCGCGCCGCGGCGAAGGTGG + Intergenic
1161304137 19:3557551-3557573 TGGGGCGGACGCGGCGGACGTGG - Exonic
1161353383 19:3805959-3805981 CGGGGCCGGCGGGGCGGAGAGGG - Exonic
1161374716 19:3933521-3933543 GGAGGCCGCCCCGGGGGAGGCGG - Exonic
1161401332 19:4067218-4067240 CGGGCCCCCCGGGGTGGAGGGGG + Intergenic
1161443290 19:4304626-4304648 CGGGGGCGCGGCGGCGGCGAGGG + Exonic
1161473401 19:4472471-4472493 CGGGGGCCCCGGGCCGGAGGCGG + Intronic
1161505096 19:4639544-4639566 CGGGGCCGTTGCCGCGGCGGTGG - Intronic
1161692549 19:5745190-5745212 GGGGGAGGCCGCGGCGGCGGAGG - Intronic
1161771701 19:6234284-6234306 CTTGGCCGCCCCTGCGGAGGGGG + Intronic
1161963646 19:7535950-7535972 CGGGGCCGGAGTGGCGGTGGTGG + Exonic
1161973338 19:7595993-7596015 CGGCGCCGCCATGGTGGAGGCGG + Exonic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162470870 19:10871479-10871501 CCGGGCCGCGGCGACGGTGGCGG + Intergenic
1162609525 19:11738589-11738611 CGGGGCCGCAGCGGCCGAGCAGG + Intronic
1162751758 19:12833851-12833873 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1162751761 19:12833857-12833879 GGGGACCGCGGCGGCGGCGGCGG - Intronic
1162752688 19:12838522-12838544 TGCGGCAGCAGCGGCGGAGGCGG - Exonic
1162778625 19:12995497-12995519 CGCGGCGGCTGCGGCGGCGGCGG + Intergenic
1162778643 19:12995567-12995589 CGCGGCGGCAGCGGCGGCGGCGG + Intergenic
1162895963 19:13764799-13764821 CGGGGCGGCCGGGTTGGAGGTGG + Intronic
1162979244 19:14228014-14228036 CGGGGCTGGCGCGGTGGAGGGGG + Intergenic
1163029815 19:14536979-14537001 CGGGGCCGAGGAGGAGGAGGTGG + Intronic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163455487 19:17403737-17403759 CTGGGGCGCCGCAGCGGAGCTGG + Exonic
1163508026 19:17719696-17719718 TGGGGCGGCGGCGGCGGCGGCGG + Intronic
1163607098 19:18281491-18281513 CCGGGCCGGCGCGGCGGGGGAGG - Exonic
1163681283 19:18683932-18683954 CGGGGCGCGCGCGGCGGGGGCGG + Intronic
1163807253 19:19406451-19406473 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1165157407 19:33796704-33796726 GGAGGCGGCGGCGGCGGAGGCGG + Intronic
1165204517 19:34172448-34172470 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1165204518 19:34172451-34172473 CGGCGCGGCGGCGGCGGCGGCGG - Intergenic
1165349520 19:35268516-35268538 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1165493946 19:36141120-36141142 GGGGGCGGCGGCGGCGGCGGCGG + Exonic
1165510968 19:36266524-36266546 CGGGGCGGCGGTGGCGGCGGTGG - Intergenic
1165803114 19:38565123-38565145 GGGCGCGGGCGCGGCGGAGGCGG + Exonic
1166110899 19:40622457-40622479 CGGGGCAGGGGTGGCGGAGGTGG - Exonic
1166210348 19:41302829-41302851 CGGGGCCGCGGGGGTGGTGGTGG + Exonic
1166304257 19:41928598-41928620 CGGCGGCGGCGCGGGGGAGGGGG + Intronic
1166358577 19:42242239-42242261 CCCGGCGGCAGCGGCGGAGGAGG - Exonic
1166807693 19:45496976-45496998 CAGGGCGGCGGCGGCGGCGGCGG - Exonic
1167056054 19:47112319-47112341 CCGGGCCGCGGAGGAGGAGGAGG - Intronic
1167145813 19:47680456-47680478 CGGGGCCGCTCCGGTGGTGGTGG - Exonic
1167237172 19:48322060-48322082 AGCAGCCGCCGCCGCGGAGGGGG - Intronic
1167249995 19:48394541-48394563 CGGGGCTGAAGCGGCAGAGGGGG + Intergenic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1167445291 19:49533890-49533912 CGGGGCCGGCGCGGAGAGGGTGG + Intronic
1167466050 19:49651613-49651635 CCCGGCCGCCGGGGCGGAAGAGG - Exonic
1167613362 19:50517798-50517820 CGTGGCCGCCGCGGCCGCCGTGG - Exonic
1167633489 19:50639817-50639839 CGGGGCTGCGGCGGCGGCGGCGG - Intronic
1167638533 19:50668242-50668264 CGGGGCCGCCCTGGTGGGGGCGG - Exonic
1167643704 19:50695087-50695109 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1167643706 19:50695093-50695115 CGGGGACGCGGCGGCGGCGGCGG - Intronic
1167649046 19:50719628-50719650 CGCGGCGGCCGCGGCGGAAGGGG - Intergenic
1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG + Intergenic
1167952427 19:53037968-53037990 CGGGGCCTCCGCGGAGTGGGGGG + Intergenic
1168072972 19:53963013-53963035 CGGGGCCGGCGGGGCTGGGGAGG - Intergenic
1168336518 19:55600336-55600358 CGGGGCCGGCGCGTGGGAAGGGG - Intronic
1168339515 19:55615136-55615158 GGCGGCGGCCGCGGCGGCGGTGG + Exonic
1168643348 19:58044521-58044543 CGCGGCCGCCGCGGAGAAGGAGG + Intronic
1202683113 1_KI270712v1_random:28798-28820 GGGGGGAGCCGCGGCGGATGGGG - Intergenic
1202712353 1_KI270714v1_random:25352-25374 AGGGGCGGCGGCGGCGGCGGCGG + Intergenic
925610406 2:5696861-5696883 CGGGGCCGCCGCAACGAAGGTGG + Exonic
926089873 2:10043192-10043214 CGGGGGCGGCGGGGCGGAGGGGG - Intronic
926089891 2:10043226-10043248 GGGGGCGGCGGGGGCGGAGGGGG - Intronic
926089901 2:10043244-10043266 GGGGGCGGCGGGGGCGGAGGGGG - Intronic
926089993 2:10043517-10043539 CGGGGCGGCCGCGGAGGGAGCGG - Intronic
926101640 2:10122233-10122255 CCGGGCCGCCGCCGGGCAGGGGG - Intergenic
927215830 2:20667360-20667382 GGGGGCGGCGGCGGCGGCGGCGG + Exonic
927472284 2:23385450-23385472 CGAGGCGGCGGCGGCGGCGGCGG - Exonic
927472320 2:23385563-23385585 GGAGGCGGCGGCGGCGGAGGAGG + Exonic
927714281 2:25342105-25342127 CGGGGCCAGCGCGGCCGCGGGGG - Intronic
927714317 2:25342177-25342199 CCGGGGCGCCGCGGCGGGAGCGG + Intronic
927881458 2:26692710-26692732 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
927920798 2:26970774-26970796 CGAGGCGGCTCCGGCGGAGGCGG - Exonic
928964823 2:36966337-36966359 CGGGGCGGCTGCGGCGGGGGCGG - Exonic
929604701 2:43226657-43226679 CGGGGCGGGCGCGCCGGGGGAGG + Intergenic
929701824 2:44169028-44169050 CGAGGCTGCGGCGGAGGAGGTGG + Exonic
930136231 2:47906066-47906088 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
930189210 2:48440812-48440834 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
930358222 2:50346882-50346904 GGGGGCGGCGGCGGCGGCGGCGG - Intronic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931257436 2:60585547-60585569 AGAGGCGGCAGCGGCGGAGGTGG - Intergenic
931602596 2:64019228-64019250 GGTGGCAGCAGCGGCGGAGGCGG - Intergenic
931657588 2:64524360-64524382 GGGGGTCTCCGCGGAGGAGGTGG + Exonic
931719439 2:65056561-65056583 CGGGGGTGCCGCGGCGCTGGGGG + Intronic
931763598 2:65436190-65436212 CGGGGGCGCCGCGGCAGCGGGGG - Intergenic
932231497 2:70087556-70087578 GCGGGCGGCGGCGGCGGAGGGGG - Exonic
932345866 2:70994830-70994852 CGCGGCGGCGGCGGCGGCGGTGG - Exonic
932345868 2:70994836-70994858 CGGGGACGCGGCGGCGGCGGCGG - Exonic
932496590 2:72148637-72148659 TGGGGCGGCGGCGGCGGCGGCGG + Intergenic
932607672 2:73175829-73175851 AGGGCCCGCGGCGGCGGGGGCGG + Intergenic
932621870 2:73269457-73269479 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
932699674 2:73984590-73984612 CGGGGCCGGCGAGGCGGGGTGGG - Intergenic
932780088 2:74554239-74554261 CGGGGCGGCCCCGGTGGTGGCGG + Exonic
933666714 2:84970832-84970854 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
933666734 2:84970926-84970948 CGGGGGCGACGCGGCGACGGCGG - Intergenic
933666859 2:84971282-84971304 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
933684611 2:85133419-85133441 CTGGGACGCCCCGGCGGAGCAGG + Exonic
933684714 2:85133703-85133725 GGGGGCGGCGGCGGCGGCGGCGG + Exonic
933907961 2:86914016-86914038 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933907986 2:86914080-86914102 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908006 2:86914129-86914151 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908045 2:86914234-86914256 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908062 2:86914281-86914303 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908080 2:86914330-86914352 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908096 2:86914376-86914398 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908110 2:86914416-86914438 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908136 2:86914492-86914514 CCGGGCTGCGGCGGCGGCGGCGG + Intronic
933908154 2:86914541-86914563 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908177 2:86914608-86914630 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908189 2:86914642-86914664 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908202 2:86914679-86914701 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908216 2:86914719-86914741 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908260 2:86914845-86914867 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908290 2:86914931-86914953 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
934011432 2:87824750-87824772 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934011548 2:87825378-87825400 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934011565 2:87825424-87825446 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934079115 2:88452455-88452477 CGGGGCGGCGGCGGTGGCGGCGG + Exonic
934248170 2:90324633-90324655 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248185 2:90324694-90324716 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248359 2:90325307-90325329 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248370 2:90325345-90325367 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248381 2:90325383-90325405 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248397 2:90325447-90325469 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934261192 2:91478104-91478126 CGGGGCGGCGGCGGCGGCGGCGG - Intergenic
934296833 2:91749086-91749108 GGGCGCCGCCGCGGCGCTGGTGG - Intergenic
934304464 2:91809921-91809943 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
934328793 2:92042829-92042851 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934566972 2:95346589-95346611 CGGCGGCGGCGCGGCGGCGGGGG - Intronic
934763842 2:96869739-96869761 GGGAGCCGCGGCGGCGGAGACGG - Intronic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
935112317 2:100104803-100104825 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
935196644 2:100820240-100820262 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
935196647 2:100820246-100820268 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
935592439 2:104855287-104855309 GGGGGCCGCGGCGGCGGCGGCGG + Intergenic
935592442 2:104855293-104855315 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
935592499 2:104855414-104855436 GGGGGGCGCGGCGGCGGCGGCGG + Intergenic
935592501 2:104855420-104855442 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
935592697 2:104856100-104856122 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
935692614 2:105744880-105744902 CGCGGCAGCGGCGGCGGCGGCGG - Exonic
936122682 2:109760392-109760414 CGGGGCGGGGGCGGCGGCGGCGG + Intergenic
936122684 2:109760398-109760420 GGGGGCGGCGGCGGCGGCGGCGG + Intergenic
936126699 2:109794582-109794604 GGGGGCGGCGGCGGCGGCGGCGG + Intronic
936222009 2:110611075-110611097 GGGGGCGGCGGCGGCGGCGGCGG - Intergenic
936222011 2:110611081-110611103 CGGGGCGGGGGCGGCGGCGGCGG - Intergenic
936433227 2:112482120-112482142 CGGGGCCGCGCCGGCGGGGGCGG + Intergenic
937045151 2:118847185-118847207 GGGGGCCGGCGCGGCGGCCGGGG - Exonic
937608272 2:123827235-123827257 AGGGGACGCCGAGGCAGAGGAGG + Intergenic
938018395 2:127885993-127886015 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
938038140 2:128053520-128053542 TGGGGCGGCGGCGGCGGGGGCGG - Intergenic
940301010 2:152176215-152176237 CGGAGCTGCCGGCGCGGAGGTGG + Intergenic
941119108 2:161507854-161507876 CGCGGCGGCGGCGGCGGCGGGGG - Intronic
941119114 2:161507860-161507882 TGGGCCCGCGGCGGCGGCGGCGG - Intronic
941906165 2:170717056-170717078 CGGCGCCCCCGAGGCGGAGCCGG + Exonic
942116782 2:172735888-172735910 CGGGGTCCGCGCGGCGGACGAGG + Exonic
942450916 2:176107623-176107645 GGGGGCGGCCCCGGCGGGGGCGG + Exonic
942450940 2:176107700-176107722 GGCGGCCGCGGCGGCCGAGGAGG + Exonic
942890489 2:180981003-180981025 GGGGGCGGCCGGGGCGGCGGCGG + Intronic
942890495 2:180981012-180981034 CGGGGCGGCGGCGGCGGTGGGGG + Intronic
943060503 2:183037957-183037979 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
943173328 2:184433107-184433129 CGGGGGTGGCGCGGGGGAGGTGG - Intergenic
943185316 2:184598924-184598946 AGCGGCGGCTGCGGCGGAGGAGG + Exonic
943646149 2:190408915-190408937 CGGGTCGGCCCGGGCGGAGGAGG - Intronic
943669873 2:190649117-190649139 CTTGGCCGCGGCGGCGGCGGCGG - Intronic
944183847 2:196926630-196926652 GGGGGCGGCGGCGGCGGCGGCGG - Exonic
944495851 2:200306835-200306857 GGGAGGCGCCGCGGCGGTGGCGG - Intronic
944716004 2:202376509-202376531 CGAGGCGGCGGCGGCGGCGGCGG + Intergenic
944743670 2:202635353-202635375 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
944831220 2:203535343-203535365 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
945431726 2:209772239-209772261 CGCGGCCTCAGCGGCGGCGGCGG - Intronic
945466016 2:210171321-210171343 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
946306525 2:218859749-218859771 CGGGGCCGAGGCGGGGGCGGGGG - Intergenic
946306559 2:218859860-218859882 CGAGGAGGGCGCGGCGGAGGCGG - Exonic
946421978 2:219570497-219570519 CGAGGCCCCCGCGCCGGTGGTGG - Exonic
946692289 2:222319077-222319099 GGGGGCAGCGGCGGCGGCGGCGG - Intergenic
946692486 2:222319760-222319782 CGCGGCGGCAGCGGCGGCGGCGG + Intergenic
946921425 2:224585153-224585175 CTGGGCAGCCGCGGCGGCGGCGG + Exonic
946921435 2:224585174-224585196 GGGGGCGGCGGCGGCGGCGGCGG + Exonic
947353641 2:229271343-229271365 CCGGGCGGCGGCGGCGGGGGAGG - Intergenic
947641163 2:231708607-231708629 GGAGTCCGCGGCGGCGGAGGAGG - Exonic
947860528 2:233354561-233354583 TCGGGCGGCGGCGGCGGAGGCGG - Exonic
947860565 2:233354707-233354729 CGGGGCTGCCGCGGCGTGAGGGG - Intronic
947872480 2:233447127-233447149 CGTGGGCACCGCGGCGGGGGAGG - Intronic
948140475 2:235669505-235669527 CGGGAGCGCGGCGGCGGCGGCGG - Intronic
948487253 2:238288760-238288782 CGACTCGGCCGCGGCGGAGGCGG - Intronic
948805769 2:240453002-240453024 TGGAGCCGCCGCTGCGAAGGGGG + Intronic
1168757400 20:326559-326581 CGGGGAGGCGGCGGCGGCGGCGG - Exonic
1168855067 20:1002353-1002375 AGGAGCCGGCGCGGCGGGGGCGG + Intergenic
1169171828 20:3471350-3471372 CGAGGCCGCGGCGGCGGCGGCGG + Exonic
1169214726 20:3786509-3786531 CGGGGCGGCGGCGGCGGCGCCGG - Exonic
1169424205 20:5483796-5483818 CGGGGCGGGCGGGGCGGGGGAGG + Intergenic
1169557567 20:6767516-6767538 CCGGGCAGCCGCGGCGGGGTGGG - Intergenic
1170150081 20:13220138-13220160 CTGGGCCGGCGCTGGGGAGGAGG + Intergenic
1170163951 20:13343566-13343588 CGGGGGCGGCGGGGCGGGGGTGG - Intergenic
1170999357 20:21397153-21397175 CGCGGCGGCCGCGGCGGCGGCGG - Exonic
1171361616 20:24590268-24590290 TGGGGCCGGCGCGGCGGGGCTGG + Intronic
1171430917 20:25082617-25082639 CGTGGCACCGGCGGCGGAGGTGG - Intergenic
1171473564 20:25390620-25390642 CGCGGCGGCCGAGCCGGAGGAGG + Exonic
1171977592 20:31605410-31605432 GGGGCCCGCGGCGGCGGTGGCGG - Exonic
1172015430 20:31870260-31870282 CCGGGCCGCGGCGGCCGGGGCGG + Intronic
1172083219 20:32358680-32358702 TGGGGCGGCGGCGGCGGTGGGGG - Exonic
1172083223 20:32358686-32358708 CGGGGCTGGGGCGGCGGCGGCGG - Exonic
1172117982 20:32583316-32583338 CCGGGCGGCCGCGGAGGGGGAGG + Intronic
1172367910 20:34363731-34363753 CGGGGCCGGCGCGGGCGACGTGG + Intronic
1172367971 20:34363935-34363957 CGGCGCCGCCACGACGGTGGCGG - Intronic
1172848415 20:37944165-37944187 CGGGGCGGGCGCGGCGGGAGGGG - Exonic
1172951216 20:38724499-38724521 CGGAGCGGCGGCGGCGGCGGTGG - Exonic
1173672873 20:44810293-44810315 CTCGGCCGCGGCGGCGGCGGCGG + Intronic
1173672876 20:44810299-44810321 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1173803735 20:45911097-45911119 CGGGGCCTCGGCGGTGGAGGCGG - Intronic
1173909141 20:46651282-46651304 CGGGGGCGCACAGGCGGAGGAGG + Intronic
1174246777 20:49187955-49187977 CGGGGCCTTCCCGGAGGAGGCGG - Intronic
1174467948 20:50731740-50731762 AGGGGCCGCCCGGCCGGAGGAGG + Exonic
1174607038 20:51768459-51768481 CCGCGCCGCCCCGGGGGAGGAGG + Exonic
1175429104 20:58890254-58890276 GGCGGCGGCCGCGGCGGCGGCGG - Intronic
1175429375 20:58891242-58891264 AGCGGCCGCGGCGGCGGCGGCGG - Intronic
1175429376 20:58891245-58891267 AGGAGCGGCCGCGGCGGCGGCGG - Intronic
1175715501 20:61252396-61252418 CGGGGGAGCGGCGGCGGCGGCGG + Intergenic
1175847006 20:62064802-62064824 CGGGCCCGGCGCGGCGGCTGCGG - Exonic
1175847103 20:62064995-62065017 CGGGGGCGGGGCGGCGGCGGGGG + Exonic
1175847105 20:62065001-62065023 CGGGGCGGCGGCGGGGGCGGCGG + Exonic
1175847477 20:62066127-62066149 CGCGGGCGCCGGGGCGGTGGCGG + Intergenic
1176016802 20:62938116-62938138 GGGGGCCGCGGCGGAGGCGGGGG - Exonic
1176016805 20:62938119-62938141 GGTGGGGGCCGCGGCGGAGGCGG - Exonic
1176054779 20:63138999-63139021 CGGGGCAGCCACGGTGGAGACGG + Intergenic
1176143051 20:63553583-63553605 AGGGGCCGTTGCGGGGGAGGGGG + Intronic
1176207107 20:63895196-63895218 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1176274454 20:64255877-64255899 AGGGGCGGCGGCGGCGGCGGCGG - Intronic
1176418923 21:6499021-6499043 GCGGGCCGGCGCGGCGGTGGCGG - Intergenic
1176455972 21:6911145-6911167 GGGGGCCCCCGAGGAGGAGGAGG + Intergenic
1176548599 21:8212238-8212260 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176549009 21:8213556-8213578 CGGCGCGGCCGAGCCGGAGGCGG - Intergenic
1176549394 21:8214732-8214754 CGGGGCGGCGGCGGCGGTGGCGG + Intergenic
1176556493 21:8256446-8256468 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176557287 21:8258955-8258977 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1176567530 21:8395273-8395295 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176568322 21:8397766-8397788 CGGGGCGGCGGCGGCGGTGGCGG + Intergenic
1176575432 21:8439488-8439510 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176576229 21:8441990-8442012 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1176834146 21:13776193-13776215 GGGGGCCCCCGAGGAGGAGGAGG + Intergenic
1177011052 21:15730365-15730387 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1177011059 21:15730374-15730396 CATGGCCCCCGCGGCGGCGGCGG - Exonic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1178493722 21:33070413-33070435 GGGGGCCGTCGTGGAGGAGGAGG - Exonic
1178673884 21:34614879-34614901 GGGGGCGGCCGAGGCGGACGAGG - Exonic
1178673906 21:34614954-34614976 CGCGGCGGAGGCGGCGGAGGCGG - Exonic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1178680451 21:34669394-34669416 CGAGGCCGCGGAGCCGGAGGGGG + Exonic
1178680763 21:34670369-34670391 CTGGGACGCAGCGGAGGAGGCGG + Exonic
1178684823 21:34702604-34702626 CAGGGCAGGCGCAGCGGAGGTGG + Intronic
1178865091 21:36320393-36320415 TGGGGCCGACGCGGCGGCGGGGG + Intronic
1178914582 21:36699393-36699415 GGGGGCGGCCGGCGCGGAGGCGG - Exonic
1178992481 21:37367202-37367224 CGGGGCCCGGGCGGCGGCGGCGG - Intronic
1179561591 21:42219235-42219257 GGGGGCGGCGGCGGCGGCGGCGG - Exonic
1179586421 21:42376515-42376537 CGGGGCCGCAGCGGTGGGCGAGG - Intronic
1179674908 21:42974752-42974774 CCGGGCGGCAGCGGCGGCGGCGG - Intronic
1179694416 21:43107343-43107365 GCGGGCCGGCGCGGCGGTGGCGG - Intronic
1180014711 21:45074596-45074618 CGTGGCGGCGGCGGCGGCGGCGG + Intronic
1180014764 21:45074806-45074828 CGGGGCCGCGGCGGCTCGGGCGG + Intronic
1180042749 21:45288344-45288366 CGGGGGCGGGGCGGAGGAGGGGG + Intergenic
1180064349 21:45405173-45405195 CGGGTGCACCGCGGCGGAGGAGG + Intronic
1180285524 22:10741747-10741769 CTGGGCCCCCGCGGCGGAAGGGG - Intergenic
1180891406 22:19291650-19291672 CGGGACCTCGGCGGCGGCGGCGG + Exonic
1181024043 22:20117628-20117650 TGGGGGCGCGGCGGCGGCGGCGG - Exonic
1181026852 22:20131824-20131846 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1181068773 22:20319955-20319977 CGCGGCCGCCTTGGAGGAGGTGG - Exonic
1181147391 22:20858685-20858707 CGGGGAGGCGGAGGCGGAGGCGG - Exonic
1181534251 22:23533527-23533549 CGAGGCCCCAGCGGCGGAAGAGG + Intergenic
1181851422 22:25752730-25752752 AGTGGACGCCGAGGCGGAGGAGG - Intronic
1181902676 22:26169316-26169338 AGGGGCCGCGGCGGCGCCGGGGG - Intergenic
1182226177 22:28800432-28800454 CGGGGCTCCGGCGGCGGAGGCGG + Exonic
1182321340 22:29480104-29480126 GGGGGCCGCAGGGGAGGAGGCGG + Intergenic
1182475521 22:30574590-30574612 CGCGGCAGCGGCGGCGGGGGCGG - Intergenic
1182475522 22:30574593-30574615 CGGCGCGGCAGCGGCGGCGGGGG - Intergenic
1182532122 22:30968843-30968865 AGCGGCGGCGGCGGCGGAGGCGG - Intergenic
1182658193 22:31906247-31906269 CAGGGCAGCAGCGGCGGCGGCGG + Exonic
1182663980 22:31944329-31944351 CCGGGCGGCGGCGGCGGCGGTGG + Intronic
1183247214 22:36703232-36703254 CCGGGCAGCGGCGGCGGCGGCGG + Exonic
1183427207 22:37746310-37746332 AGGGGCGGCGGCGGCGGCGGCGG + Intronic
1183524932 22:38317287-38317309 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1183912947 22:41092437-41092459 AGGGGCCGGTGCGGCGGCGGCGG + Exonic
1184439219 22:44498304-44498326 CGGGGCCGGCGCGGTGGCGGTGG + Intergenic
1184680711 22:46071121-46071143 CGGGGCCCGCGCGGCCGAGGCGG - Intronic
1184767033 22:46577397-46577419 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1184891056 22:47379348-47379370 GGAGGCGGCGGCGGCGGAGGCGG + Intergenic
1184891061 22:47379363-47379385 GGAGGCGGCGGCGGCGGAGGAGG + Intergenic
1185015329 22:48339453-48339475 TGGGGCCGCCTCTGCAGAGGGGG + Intergenic
1185037937 22:48489469-48489491 CGCGGCGGCGGCGGCGGCGGAGG + Exonic
1185055262 22:48575860-48575882 CTGGCCCGCCGCGGCGGCGGTGG + Intronic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185255076 22:49827417-49827439 CCGGGCCGAGGCGGCGGCGGCGG + Intronic
1185255126 22:49827542-49827564 GGGGGCCGGCGCGGCCGAGGCGG + Intergenic
1185255156 22:49827638-49827660 CGGAGCCGCCGCGGCCGAGAGGG - Intergenic
1185272693 22:49936091-49936113 CGGGGCCGGGGCGGCGGGGGAGG - Intergenic
1185278623 22:49960658-49960680 CGGGGCCCGCGAGGCGGCGGCGG - Exonic
1185313797 22:50170394-50170416 CCGGGCCGGGGCGGCGGCGGGGG - Intergenic
1185374292 22:50474965-50474987 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1185409437 22:50674434-50674456 AGGGGCGGCGGCGGCGGCGGCGG - Intergenic
1203252494 22_KI270733v1_random:124758-124780 CGCGACCGCGGCGGCGGTGGTGG + Intergenic
1203254279 22_KI270733v1_random:131048-131070 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203255059 22_KI270733v1_random:133695-133717 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1203261537 22_KI270733v1_random:173621-173643 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203262335 22_KI270733v1_random:176127-176149 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203263115 22_KI270733v1_random:178774-178796 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
950316219 3:12004286-12004308 CGGGGCCGCCTCTGCGGCGCGGG + Intergenic
950316325 3:12004682-12004704 GGGCGCCGCCGAGGCCGAGGCGG - Exonic
950487805 3:13283112-13283134 GGGGGCGGCGCCGGCGGAGGCGG - Intergenic
950583489 3:13878167-13878189 CGGGGAGGCCGCGGCGCCGGCGG + Intronic
951078571 3:18425346-18425368 GGCGGCGGCGGCGGCGGAGGAGG + Intronic
951208326 3:19947271-19947293 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
951907894 3:27721908-27721930 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
951907897 3:27721914-27721936 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
952241229 3:31532948-31532970 CCAGGCGGCGGCGGCGGAGGAGG + Exonic
952908930 3:38165768-38165790 TGGGGGCGCGGCGGCGGCGGCGG + Exonic
953096277 3:39779886-39779908 CGGGCCAGCAGCTGCGGAGGGGG + Intergenic
953326101 3:42013695-42013717 CGGGGGCGCTGCTGCGGACGCGG - Intergenic
953518822 3:43622082-43622104 CGGGGCCGCGGCGGGAGAGGCGG + Intronic
953801083 3:46023123-46023145 CGGGGTCGCGGCGGCGGCGCAGG + Intronic
953947774 3:47164012-47164034 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
954004232 3:47578916-47578938 CGGGGCCGGCGCGGCGGGCGGGG - Exonic
954389252 3:50260302-50260324 CGGGGTCGGCGCCGCGGAGGCGG + Intergenic
954632763 3:52056222-52056244 CGGGGCGGGCGCGGCGACGGGGG - Exonic
954912700 3:54122401-54122423 CGGGGCCGCCGAGGCGGGGCCGG + Intergenic
955769246 3:62372549-62372571 CGGGCGGGCGGCGGCGGAGGCGG - Exonic
955911539 3:63863797-63863819 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
955911572 3:63863957-63863979 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
956678013 3:71753638-71753660 AGGGGGCTCCGCGGCGGCGGCGG + Intronic
956678017 3:71753647-71753669 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
956761301 3:72447209-72447231 CGGCGCCGCGAGGGCGGAGGCGG + Intergenic
959513501 3:107240556-107240578 CGGGGCAGCCGGGGCGGAAGGGG - Intergenic
960664219 3:120094382-120094404 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
960939043 3:122921869-122921891 CGAGGCCTCCACTGCGGAGGAGG - Intronic
961377433 3:126476060-126476082 CGGGGCGCCGGAGGCGGAGGCGG + Intergenic
961574452 3:127823217-127823239 CTGGGCCGGCTCGGCGGCGGGGG + Intronic
961734668 3:128993918-128993940 CCGGGCTGCGGCGGCCGAGGTGG + Intronic
961858247 3:129893662-129893684 CGGGGCTGAGGCGGCGGCGGCGG - Intergenic
961929374 3:130517100-130517122 CGGGGCCGCCGGGGCGGGGAAGG + Intergenic
962277958 3:134030042-134030064 GGGGGCGGCGGCGGCGGCGGCGG - Exonic
962301816 3:134250395-134250417 TGGGGCCGCCGAGGCCGGGGCGG - Intronic
962808893 3:138945765-138945787 CGGGGCCGCCGCGCCGCCGCCGG - Exonic
963038378 3:141051394-141051416 GCGGGCGGCGGCGGCGGAGGAGG + Exonic
963091399 3:141486931-141486953 CGGGGCCGCGGCGGGCGGGGCGG + Intergenic
963253370 3:143121138-143121160 CGGGGCGGCCCGGCCGGAGGCGG - Exonic
964219119 3:154324283-154324305 GGAGGCGGCGGCGGCGGAGGGGG - Exonic
965590665 3:170357780-170357802 CGGCGGCGACGCGGCGGAGGCGG + Intronic
966182201 3:177197563-177197585 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
966849403 3:184155445-184155467 AGCGGCGGCCGCGGCGGCGGCGG + Exonic
966868557 3:184276012-184276034 GGGGGCGGCCGCGGCCGAGCGGG + Intronic
967118394 3:186361916-186361938 GGCGGCCGGCGCGGCGGAGGGGG - Intronic
967166323 3:186783229-186783251 CGGGGGAGCCGCGCCGGAGCCGG - Intronic
967316247 3:188154213-188154235 CGGGGCAGCGGCGGTGGTGGTGG - Intronic
968048083 3:195635284-195635306 CGGGGCAGCTGCGGGGGAGGCGG - Intergenic
968099319 3:195954336-195954358 CGGGGCAGCTGCGGGGGAGGCGG + Intergenic
968306528 3:197654637-197654659 CGGGGCAGCTGCGGGGGAGGCGG + Intergenic
968434124 4:576242-576264 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
968434126 4:576248-576270 CGGGGTCGCGGCGGCGGCGGCGG - Intergenic
968514393 4:1010202-1010224 CAGGGCCGCGGCGGCGGCGCAGG + Intronic
968550586 4:1221725-1221747 CGGGGCCGCCACGGGAGAAGGGG + Intronic
968653067 4:1767555-1767577 CGAGGCCGCCGGGTCGGGGGCGG + Intergenic
968660140 4:1795428-1795450 CGGGGGCGCCGCCCCGGGGGAGG - Intronic
968671778 4:1855989-1856011 CGCGGCCGCCGCGGAGAAGGAGG - Exonic
968674964 4:1872009-1872031 CGGGGCGGCCGCGGTGGGAGGGG + Intronic
968701147 4:2058919-2058941 CCGGGCGGCCGCGGAGGAGGAGG + Intergenic
968701298 4:2059399-2059421 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
968701302 4:2059405-2059427 CGGACCCGCGGCGGCGGCGGCGG - Intergenic
968756489 4:2418710-2418732 CGGGGCGGGCGGGGCGGAGGCGG + Intergenic
968815171 4:2818234-2818256 CCGGGCCGCGGCCGCGGAGCTGG + Exonic
968850489 4:3074617-3074639 CGGGGCCGCGCCGGCGGAGGCGG - Intergenic
968965150 4:3765929-3765951 CAGGGCGGCGGCGGCGGCGGCGG + Intergenic
969021706 4:4143560-4143582 TGGGGACGCCGCGGAGGAGGAGG - Intergenic
969113954 4:4859994-4860016 CGTGGCCGCGGCGGCGCTGGGGG - Exonic
969413373 4:7043528-7043550 CGGGGGCGCGGCGGCTGCGGCGG + Exonic
969732161 4:8963855-8963877 TGGGGACGCCGCGGAGGAGGAGG + Intergenic
969791757 4:9497940-9497962 TGGGGACGGCGCGGAGGAGGAGG + Intergenic
969912116 4:10456936-10456958 CGGGGCGACCGAGGCGGGGGTGG - Intronic
970333010 4:15003721-15003743 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
970456348 4:16226985-16227007 TGGCGCGGCCGCGGCGGCGGGGG + Intronic
970823944 4:20252003-20252025 GGCGGCGGCGGCGGCGGAGGCGG + Intergenic
971272163 4:25160215-25160237 CGGGGTCGCGGCGGCTGGGGAGG + Intronic
972960716 4:44448672-44448694 CGGGGCAGCGGCGGCGTCGGCGG + Exonic
973279263 4:48341909-48341931 AGGAGACGCCGCGCCGGAGGAGG - Exonic
975342629 4:73258764-73258786 CGAGGCGGTGGCGGCGGAGGCGG - Exonic
975342638 4:73258800-73258822 CGGAGCGGCGGCGGCGGCGGCGG - Intergenic
975485751 4:74933059-74933081 CGCGGCGGCGGCGGCGGAGGCGG + Intergenic
975633041 4:76421113-76421135 CGGCGCCGCAGCCGAGGAGGAGG - Intronic
975778963 4:77819611-77819633 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
975883606 4:78939396-78939418 CGGGTCCGCCGCGGCGCTGGCGG - Exonic
977693880 4:99946619-99946641 GGAAGCCGCCGCCGCGGAGGAGG + Exonic
977809919 4:101346883-101346905 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
977810065 4:101347529-101347551 GGCGGCGGCGGCGGCGGAGGGGG - Intronic
978072574 4:104491423-104491445 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
978072625 4:104491557-104491579 CGCGGCGGCCGCGGCGGCGGCGG + Exonic
978443972 4:108763116-108763138 CGCGGCCCCGGCGGGGGAGGAGG - Intergenic
978620145 4:110629398-110629420 CGGGGGCGGGGCGGCGGAGAGGG + Intronic
978777090 4:112515386-112515408 CAGGGCCGCCAAGGCGGGGGAGG + Exonic
979468967 4:121072463-121072485 CGGGGCGGCAGCGGCCGTGGCGG + Exonic
979685317 4:123505644-123505666 CGCGGCCTCGGCGGCGGCGGCGG - Intergenic
980053834 4:128061655-128061677 CGGGGCCACCCCGGCTGGGGCGG + Intronic
980920909 4:139084436-139084458 AGGGGCGGCGGCGGCGGCGGCGG + Intronic
980969384 4:139555549-139555571 CGTGGCAGCCGCGGCCCAGGCGG - Intronic
981491594 4:145346224-145346246 CGGGGCTGGCGGGGCGGCGGGGG + Intergenic
984734781 4:183099107-183099129 CGGCGCTGCCGCGGCAGCGGCGG - Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985515872 5:344252-344274 CCGGGCGGCAGAGGCGGAGGCGG + Intronic
985532686 5:443227-443249 GGGGGCGGCGGCGGCGGCGGCGG + Exonic
985660857 5:1155914-1155936 CGGGGCCGGCGGGGCGGGCGCGG + Intergenic
985688688 5:1295152-1295174 CGGGGTCCGCGCGGAGGAGGCGG + Intergenic
985743506 5:1633757-1633779 CGGGGCGGCTGCGCGGGAGGCGG + Intergenic
986152486 5:5140281-5140303 AGTGGCAGCCGCGGCGGCGGGGG - Intergenic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
986330677 5:6714130-6714152 CACGGCGGCCGCGGCGGGGGCGG + Intergenic
986330847 5:6714709-6714731 CGGGGAGGCCGCGGGGGCGGGGG + Intronic
986721472 5:10563962-10563984 GGGGGACGCCGGGGCGGAGCCGG - Intergenic
986813661 5:11385162-11385184 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
987132391 5:14871814-14871836 CCGGGCGGCGGCGGCGGCGGCGG - Intergenic
988437532 5:31193808-31193830 CGCGGCGGCGGCGGCGGCGGAGG + Exonic
988595353 5:32585755-32585777 CGGGGACGCCGAGGGGAAGGGGG - Intronic
988825325 5:34929741-34929763 CCGGGCCGAAGCGGCGGCGGCGG - Exonic
989637987 5:43556776-43556798 CGGGGCCTGGGCCGCGGAGGGGG - Exonic
989812673 5:45696213-45696235 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
990955026 5:61332324-61332346 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
990955033 5:61332345-61332367 GGGGGCAGCAGCGGCGGCGGCGG + Exonic
990955143 5:61332802-61332824 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
990955151 5:61332811-61332833 CCCGGCCCCCGCGGCGGCGGCGG - Exonic
991587736 5:68216445-68216467 CGGGGCGGGCGAGGCGGCGGTGG + Intronic
993900975 5:93584315-93584337 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
993904065 5:93604154-93604176 CGCGGCCGCCGTGGCTGGGGCGG - Intergenic
994648453 5:102498425-102498447 TGGGGCCGCACTGGCGGAGGCGG - Intronic
995106239 5:108381018-108381040 GGGGGCTGCGGCGGCGGCGGCGG - Exonic
995106328 5:108381293-108381315 CGAGGCGGCAGCGGCGGCGGCGG + Exonic
995650412 5:114362364-114362386 CGGTGCCCCGGCGGCGGGGGCGG + Exonic
996055069 5:118973696-118973718 GGAGTCCGCGGCGGCGGAGGAGG - Intronic
996900413 5:128537488-128537510 CGGGGCGGCTTGGGCGGAGGAGG + Exonic
996978488 5:129461455-129461477 GGGGGCGGCTGCGGGGGAGGCGG - Exonic
997402360 5:133612514-133612536 TAGGGCAGCCGCGGCGGCGGTGG - Exonic
997521269 5:134525856-134525878 CGGGGTCGCGGCGAGGGAGGCGG - Intronic
997653009 5:135536029-135536051 CCGGGCTGCCGCGGGGGCGGAGG - Intergenic
997899642 5:137753471-137753493 CGGGGCGGCCGAGGCGGCCGGGG - Exonic
997975377 5:138438965-138438987 GGAGGCCGCCGCGGCGGCGGCGG - Intergenic
997990808 5:138543139-138543161 CGGCGGCTCCGCGGCGGCGGCGG + Exonic
998118991 5:139561187-139561209 CGGGGCCGTGGCGGCGACGGCGG + Exonic
998130290 5:139648343-139648365 CGCGGCGGCGGCGGCAGAGGCGG + Exonic
998166674 5:139848287-139848309 CGCGGCCGCGGCGGCGGCGGGGG + Exonic
998166797 5:139848734-139848756 CCGGGCCGGCGCGGGGGAGGGGG + Intronic
998435917 5:142108790-142108812 CGGAGCCTCGGCGGCGGCGGCGG + Exonic
999322688 5:150624982-150625004 CGGCGCCGCCCAGGAGGAGGTGG + Intronic
999326937 5:150649595-150649617 CAGCCCCGCGGCGGCGGAGGAGG + Exonic
999365485 5:151020886-151020908 CGGGGTCCCGGCGGCGGAGGGGG - Intronic
999767974 5:154755410-154755432 CCGGGCCGCCCCGGGGGCGGGGG + Intronic
1000302952 5:159972312-159972334 CGTGGCGGCCGCGGCGGCCGGGG - Exonic
1001065055 5:168529538-168529560 GGGGGCGGCCGCGGGGGCGGCGG + Exonic
1001065071 5:168529577-168529599 GGGGGCCGAGGCGGCGGCGGCGG + Exonic
1001065118 5:168529694-168529716 CGGGGGCGCGGCGGCGGCGACGG + Exonic
1001342835 5:170862628-170862650 CGCGGCCGCCTCTTCGGAGGAGG + Intronic
1001530002 5:172454708-172454730 CTGAGCCGCCGCGCCGGGGGAGG + Intergenic
1001688785 5:173616543-173616565 CAAGGCGGCAGCGGCGGAGGTGG + Exonic
1002006428 5:176238407-176238429 CGGGGCGGCGGCAGCGGCGGCGG - Exonic
1002498511 5:179632369-179632391 CCTGGCCGCGGCGGGGGAGGGGG - Intronic
1002691373 5:181053008-181053030 GGGGGCGCGCGCGGCGGAGGGGG - Intronic
1002784481 6:391558-391580 GGGGGCTGCCGCGGCCGGGGTGG - Intergenic
1002897959 6:1390051-1390073 CGGGGCGGCGGCGGCGGCGGCGG - Exonic
1002927001 6:1610526-1610548 CGCGGCGGCCGCGGCGGCCGGGG + Exonic
1003107465 6:3227463-3227485 TGGGCGCGCCGCAGCGGAGGGGG - Intronic
1003532864 6:6952479-6952501 CGGGCCAGCAGCTGCGGAGGGGG + Intergenic
1003551832 6:7107682-7107704 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1003551835 6:7107688-7107710 AGCGGCCGCGGCGGCGGCGGCGG - Intronic
1003551836 6:7107691-7107713 CTGAGCGGCCGCGGCGGCGGCGG - Intronic
1003872250 6:10412527-10412549 GGGGGAGGCCGCGGGGGAGGGGG + Intronic
1004043985 6:12009245-12009267 CGTGGACGCAGCGGCGGGGGCGG + Intronic
1004395695 6:15245250-15245272 CGGGGCCCGGGGGGCGGAGGAGG + Intergenic
1004561869 6:16760229-16760251 GGCGGCGGCCGCCGCGGAGGAGG - Intronic
1004690225 6:17987290-17987312 CCGGGGGGCCGGGGCGGAGGCGG - Intronic
1004690342 6:17987683-17987705 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1004864279 6:19837868-19837890 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
1004924051 6:20402372-20402394 CGGGGCGGCGGCAGCGGCGGCGG - Exonic
1004924115 6:20402593-20402615 CGCGGCGGCAGCGGCGGCGGCGG + Exonic
1004924531 6:20403858-20403880 CGGTGCCCCCGCGGCGTCGGCGG - Intronic
1006089752 6:31621186-31621208 CGGGGCGGCAGCCGGGGAGGGGG - Intronic
1006340517 6:33443907-33443929 GGGGGCAGCGGTGGCGGAGGGGG + Exonic
1006472658 6:34237331-34237353 GGGGCCCGCGGCGGCGGCGGCGG + Intronic
1006472664 6:34237337-34237359 CGCGGCGGCGGCGGCGGAGGGGG + Intronic
1006677736 6:35776516-35776538 CCAGGCCACCCCGGCGGAGGAGG - Intergenic
1007557823 6:42782029-42782051 AGGGGCGGCGGCGGCGGCGGCGG - Exonic
1007557938 6:42782518-42782540 CGGGGGCGCCTCGGCGGGGTGGG + Intronic
1007665357 6:43510148-43510170 CGCGGTCGCGGCGGCGGCGGCGG + Exonic
1007702211 6:43771883-43771905 CGGGGTTGGCGCGGCGCAGGTGG - Intronic
1007739635 6:44002766-44002788 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1007902043 6:45422023-45422045 AGCGGCGGCCGCCGCGGAGGCGG + Intronic
1007902044 6:45422026-45422048 GGCGGCCGCCGCGGAGGCGGCGG + Intronic
1007927676 6:45663346-45663368 CGGGGCGGCCTCCGGGGAGGAGG - Intronic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1009431834 6:63573254-63573276 CGGGGAGGGCGCGGCGGTGGCGG + Intronic
1009975598 6:70667859-70667881 AGGGGCGGCGGCGGCGGTGGCGG - Exonic
1010001778 6:70956252-70956274 CCGGGCCGCCCCTGCGGAGCGGG + Exonic
1010141920 6:72622249-72622271 CGGCGCAGCGGCGGCGGCGGCGG + Exonic
1010229438 6:73521615-73521637 CGCGGAAGCCGGGGCGGAGGAGG - Intronic
1011470253 6:87701514-87701536 CGAGGCGGCCGCAGCGGAGAAGG + Exonic
1011470269 6:87701565-87701587 CGGGGAGGCAGCGGCCGAGGTGG + Exonic
1011470368 6:87701958-87701980 CGGGGGAGCCGCGCCTGAGGAGG - Exonic
1011517132 6:88166592-88166614 CGGGAGCGCGGCGGCGGAGGAGG - Intergenic
1011633876 6:89352765-89352787 CGGGGGCGCAGTGGAGGAGGCGG - Exonic
1011640352 6:89411936-89411958 CGAGGACGACGCGGAGGAGGAGG - Exonic
1013372641 6:109483487-109483509 CGGGGGAGCCGCGGCGGGGCGGG + Intergenic
1013507594 6:110815342-110815364 CGCCGCCGTCGCGGAGGAGGAGG - Intronic
1013507596 6:110815345-110815367 CGCCGCCGCCGTCGCGGAGGAGG - Intronic
1013619423 6:111873336-111873358 GGGGGCTGCCGCGGGCGAGGAGG - Exonic
1014029109 6:116681106-116681128 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
1014029115 6:116681124-116681146 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1014045216 6:116877162-116877184 CGGGGCCGCAGGGGCGGGGAAGG - Intergenic
1015220630 6:130801468-130801490 CGGGGTGGCGGCGGCGGTGGCGG + Intergenic
1015799209 6:137044237-137044259 CCGCGCGGCCGCGGCGGTGGTGG + Intronic
1015799210 6:137044240-137044262 CGCGGCCGCGGCGGTGGTGGCGG + Intronic
1017002456 6:150005619-150005641 CGGGGACTCCGCGACGCAGGCGG - Intergenic
1017027924 6:150197716-150197738 CCTGGCCGCCACGGTGGAGGAGG + Intronic
1017027940 6:150197764-150197786 CCTGGCCGCCACGGTGGAGGAGG + Intronic
1017028029 6:150198052-150198074 CCTGGCCGCCACGGTGGAGGAGG + Intronic
1017028075 6:150198196-150198218 CCTGGCCGCCACGGTGGAGGAGG + Intronic
1017028122 6:150198340-150198362 CCTGGCCGCCACGGTGGAGGAGG + Intronic
1017164159 6:151391554-151391576 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1017164160 6:151391557-151391579 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1017672010 6:156777815-156777837 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1017672070 6:156778045-156778067 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1017672240 6:156778732-156778754 CCCGGCGGCGGCGGCGGAGGCGG - Exonic
1017672244 6:156778738-156778760 GGGGGCCCCGGCGGCGGCGGCGG - Exonic
1017672287 6:156778857-156778879 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1017672311 6:156778949-156778971 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1017793626 6:157823036-157823058 GGGGGCGGCGGCGGCGGCGGCGG + Intronic
1018613057 6:165662159-165662181 CGGGGCGGCGGCGGCGGCCGGGG + Intronic
1018695002 6:166383626-166383648 GGGAGCCGCAGCGTCGGAGGAGG + Intergenic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1018898134 6:168035424-168035446 CTGGAACGGCGCGGCGGAGGAGG + Intronic
1019111923 6:169724003-169724025 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1019111928 6:169724012-169724034 GGGGGCCCGCGCGGCGGCGGCGG - Exonic
1019262396 7:88767-88789 CAGGGCTGCAGCCGCGGAGGTGG - Intergenic
1019381679 7:727364-727386 AGGGGCCGCGGAGGTGGAGGTGG - Intronic
1019421802 7:954275-954297 CGCGGACGCCGCGGGGGTGGCGG - Intronic
1019433928 7:1012203-1012225 AGGGGCCGCCGCGGTGGCCGAGG + Intronic
1019474223 7:1236317-1236339 AGGGGCCGCTGTGGCGGCGGTGG + Exonic
1019664707 7:2246016-2246038 GGGGGCCGCAGCTGGGGAGGAGG + Intronic
1019689668 7:2403616-2403638 CGGGGCGGCGGCGGCGGCTGCGG + Exonic
1020178069 7:5898701-5898723 CGGGGCGGTGGCGACGGAGGCGG + Intergenic
1020304858 7:6826274-6826296 CGGGGCGGTGGCGACGGAGGCGG - Exonic
1020309121 7:6855590-6855612 TGGGGACGGCGCGGAGGAGGAGG - Intergenic
1021231106 7:18086903-18086925 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1021451253 7:20785338-20785360 GGGGGCAGCGGCGGCGGCGGCGG - Exonic
1021600221 7:22356985-22357007 CCTGGCCGCCGCGGCGGCGGTGG - Intronic
1022101092 7:27169606-27169628 GGCGGCGGCAGCGGCGGAGGCGG - Intronic
1022106214 7:27199670-27199692 CGAGGACGACGCGGCGGCGGCGG + Exonic
1022363354 7:29684996-29685018 CGGGGCCGCCGCGGCGCCGCCGG + Intergenic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1022427952 7:30285546-30285568 CGGCGCCGCGGCGGCCGCGGCGG + Exonic
1022427953 7:30285551-30285573 CGGGGCCGCCGCGGCCGCCGCGG - Exonic
1022427958 7:30285569-30285591 CGGGGCCGCCGGGGCTGCCGGGG - Exonic
1023177637 7:37448776-37448798 TGGGGCCGCGGCGGCGTGGGTGG + Exonic
1023875829 7:44285813-44285835 GGGGGGAGGCGCGGCGGAGGGGG + Intronic
1023881936 7:44325665-44325687 CGGGGCGGGCGCGGCGGCGGCGG - Intronic
1024521078 7:50304504-50304526 GGGGGCGGCCGGCGCGGAGGGGG + Intronic
1025069677 7:55887591-55887613 CGGGTCCACCGCGGCGGCGGCGG + Intronic
1025069682 7:55887600-55887622 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1025615706 7:63114418-63114440 AGGCGCTGCCGCGGCGGCGGCGG + Intergenic
1025615707 7:63114421-63114443 CGCTGCCGCGGCGGCGGCGGCGG + Intergenic
1025615710 7:63114427-63114449 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1025916888 7:65873237-65873259 CGCGGCGGCGGCGGCGGCGGTGG + Intergenic
1025916895 7:65873258-65873280 GGTGGCGGCGGCGGCGGAGGCGG + Intronic
1026045318 7:66902659-66902681 CGGGGCTGCCGCGAGGCAGGGGG - Intergenic
1026045596 7:66903791-66903813 CGGGGCTGCCGCGAGGCAGGCGG - Intergenic
1026817138 7:73521925-73521947 CGGCGCCATCGCGGCGGCGGCGG + Exonic
1027202481 7:76072547-76072569 CGGGGCTGCCGCGAGGCAGGTGG + Intergenic
1027228596 7:76260038-76260060 AGCGGCCGCCGCGGCGGGGGTGG + Intronic
1027390278 7:77696903-77696925 CGAGGCAGCGGCGGCGGCGGCGG - Exonic
1028173722 7:87628860-87628882 CGCGGCGGTGGCGGCGGAGGCGG + Exonic
1028762323 7:94509880-94509902 CGAGTCGGCCGCGGCCGAGGAGG + Exonic
1029123190 7:98281719-98281741 GGGGGACGCGGCGGCGGCGGCGG - Exonic
1029207699 7:98879099-98879121 CGGCGCCGCCGGGCCAGAGGGGG - Intronic
1029417201 7:100450668-100450690 CGTGGCGGCCGCGGCGAAGCTGG - Intergenic
1029461027 7:100694029-100694051 CGCGGCCGCCGCGGCGTCGGGGG + Intergenic
1029715133 7:102321554-102321576 CGGGGGCTCCTCGGCGGCGGTGG - Exonic
1029746433 7:102517817-102517839 CGGGGGCGGGGCGGCGGGGGCGG + Intergenic
1029764370 7:102616796-102616818 CGGGGGCGGGGCGGCGGGGGCGG + Intronic
1029896401 7:103989361-103989383 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1029996753 7:105014153-105014175 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1029996756 7:105014159-105014181 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
1029996757 7:105014162-105014184 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1030727196 7:112939758-112939780 AGGGGCGGCGGCGGCGGCGGCGG - Exonic
1031051884 7:116953441-116953463 CCGGGCCGCGGCGGCGGCGGCGG + Exonic
1031134833 7:117873334-117873356 GGGGGCCGCGGCGGAGGCGGCGG - Exonic
1031134834 7:117873337-117873359 GGCGGGGGCCGCGGCGGAGGCGG - Exonic
1031886857 7:127252862-127252884 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1032037367 7:128530879-128530901 GGGGGCCGCCGAGGCGGATCCGG + Intergenic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1033033150 7:137846565-137846587 AGGGTCAGCCGCGGCGGCGGGGG - Exonic
1033099980 7:138461137-138461159 CGGAGCAGCGGCGGCGGCGGCGG - Intronic
1033165521 7:139035816-139035838 CGGGGACGCGGAGGCCGAGGCGG - Exonic
1033253188 7:139777817-139777839 CCGGGCGGCAGCGGCGGCGGCGG - Intronic
1033477132 7:141702038-141702060 TGGGGCCGGGGCGGCGGCGGGGG - Exonic
1034306281 7:150047667-150047689 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1034306283 7:150047673-150047695 CGGGAGCGCGGCGGCGGCGGCGG - Intergenic
1034401413 7:150864041-150864063 CGGGGCCTCAGGGGAGGAGGGGG - Intergenic
1034440537 7:151083518-151083540 CCGGGCCGCGGCGGCGGGGAAGG - Intronic
1034441155 7:151086689-151086711 CCGGGGCGGCGCGGCGGAGGCGG - Intronic
1034441396 7:151087558-151087580 CTTGGCCGCCGCGGCGTAGGGGG - Intronic
1034469721 7:151248755-151248777 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1034469725 7:151248764-151248786 TGCGGCAGCCGCGGCGGCGGCGG - Exonic
1034494184 7:151410221-151410243 CCAGGCGGCGGCGGCGGAGGTGG - Intronic
1034500601 7:151448319-151448341 CGGGGCTGACCCGGCGCAGGAGG - Intergenic
1034708693 7:153171176-153171198 AGGGGCCGCAGCGGCAGTGGTGG + Intergenic
1034800564 7:154052980-154053002 CGGGAGCGCGGCGGCGGCGGCGG + Intronic
1035341621 7:158166299-158166321 CGCGGCGGCCGGGGGGGAGGAGG - Intronic
1035683643 8:1507601-1507623 AGTGGGCGCCGAGGCGGAGGAGG + Intronic
1036789500 8:11708671-11708693 CCGGGCCGCGGCAGCGGCGGCGG - Exonic
1037450763 8:19013890-19013912 CTGGGCCTCCGAGGCGGGGGCGG + Intronic
1037547666 8:19939844-19939866 GGGGGCCGGGACGGCGGAGGCGG + Intronic
1038632940 8:29262940-29262962 CTGGGCCGCCGGGGCGGAGGCGG - Intronic
1038633037 8:29263225-29263247 CGGGGCCGCAGCGAAGGCGGGGG + Intergenic
1039454297 8:37697299-37697321 CAGGGCCGCGGCTGCGGAGGCGG - Exonic
1039467708 8:37796358-37796380 CGAGGTCACCGCAGCGGAGGAGG + Intronic
1039595600 8:38787654-38787676 CGGGGCCGCCGGCGAGGACGAGG + Exonic
1040963978 8:53065562-53065584 CAGGGCCGCCGGGGTGGAGCCGG - Intergenic
1041059502 8:54022276-54022298 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1041355303 8:56993643-56993665 CGCGGCGGCTGCGGCGGCGGCGG - Exonic
1041689914 8:60678758-60678780 TGGGGCCGCGGCGGCGGCGGCGG + Exonic
1041689917 8:60678764-60678786 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1041690006 8:60679115-60679137 AGGGGCGGCGGCGGCGGCGGCGG + Intronic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1042040034 8:64580727-64580749 CGGGGCCGAGGCGGCGGCGGCGG + Exonic
1042040222 8:64581388-64581410 CTGGGCGGCGGCGGCGGCGGGGG + Exonic
1042829269 8:73009039-73009061 GGGGGCCCCCGAGGAGGAGGAGG + Exonic
1043502953 8:80874316-80874338 GGCGGCGGCGGCGGCGGAGGCGG - Intronic
1043502955 8:80874322-80874344 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1043769683 8:84183127-84183149 CGCGGCAGCAGCGGCAGAGGCGG + Intronic
1043873878 8:85463931-85463953 CGGGGGCGGCCCGGGGGAGGGGG - Exonic
1044115266 8:88327577-88327599 GGCGGCGGCGGCGGCGGAGGAGG - Intronic
1044115267 8:88327580-88327602 GGGGGCGGCGGCGGCGGCGGAGG - Intronic
1045118740 8:99012972-99012994 TGGGGCCGCTGCGCCGGCGGCGG - Intergenic
1045231236 8:100309595-100309617 CCGGGCCGCGGGGGCCGAGGTGG - Intronic
1045564362 8:103298789-103298811 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1045564364 8:103298795-103298817 CGGGCTCGCGGCGGCGGCGGCGG - Intronic
1045571383 8:103371828-103371850 CGGGACCGCCGCGCTGGTGGAGG + Intronic
1046547417 8:115669073-115669095 CGGGGCGGCGGCGGCGGCGCGGG - Intronic
1046871282 8:119208347-119208369 CGGGCGCGCCGCGCGGGAGGAGG - Intronic
1048214268 8:132480872-132480894 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1048945585 8:139444075-139444097 CAGGGCCCCTGCGGCTGAGGAGG + Intergenic
1048980891 8:139703084-139703106 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
1049109850 8:140635783-140635805 GGGGTCCGCGGCGGCGGCGGCGG + Intergenic
1049336672 8:142090209-142090231 CGGGGCCGCGGCTGCACAGGGGG + Intergenic
1049548570 8:143246223-143246245 CGTGGGCGCCGCGGAGGCGGGGG + Intergenic
1049694088 8:143975236-143975258 CGGAGCCGGCGCAGCGGGGGTGG - Intronic
1049752227 8:144290735-144290757 CAGCGCGGCCGCGGCCGAGGGGG + Intronic
1049759723 8:144326549-144326571 CGGGCCTGCGGCGGCGGAAGAGG - Exonic
1049762177 8:144336610-144336632 AGGCTCCGCCGCGGCGGCGGGGG - Intergenic
1049788437 8:144462372-144462394 CGAGGCGGCGGCGGCGGCGGCGG - Intronic
1049788441 8:144462381-144462403 CGAGGCGGCCGAGGCGGCGGCGG - Intronic
1049788489 8:144462537-144462559 CGGGGCGGCCGCCGGGCAGGCGG - Intronic
1049850110 8:144826455-144826477 CGGGGCAGCAGGGGCGGGGGTGG + Intergenic
1049936403 9:504878-504900 CGCGGCGGCCGTGGCGGTGGCGG + Intronic
1050472388 9:6007445-6007467 CGTTGCCACCGCGGAGGAGGAGG - Exonic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1051206373 9:14693312-14693334 CTGGGCGGCGGCGCCGGAGGAGG - Exonic
1051876757 9:21802168-21802190 CGGGGCGGCCGCCGCGGCGGGGG - Intergenic
1052903987 9:33817735-33817757 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1052903991 9:33817744-33817766 CTGGGCCATCGCGGCGGCGGCGG - Exonic
1052941497 9:34134746-34134768 CGCGGCAGCGGCGGCGGCGGCGG - Intergenic
1053001158 9:34577960-34577982 CGGGGGCGTCGCGGCGGCGGGGG + Intronic
1053014107 9:34652137-34652159 CTGGGCCCCCGCAGCGGGGGTGG - Intronic
1053072932 9:35111617-35111639 CGTGGCCGCCGCGGCGCGGGTGG - Intronic
1053152004 9:35749314-35749336 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1053240026 9:36487691-36487713 AGCGGCGGCGGCGGCGGAGGGGG + Intergenic
1053312327 9:37027554-37027576 CGGGGCTGCCGGGGCTGAGATGG + Intronic
1053697502 9:40651087-40651109 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054308791 9:63450487-63450509 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054407653 9:64774846-64774868 CGCGGCGGCTGCGGCGGCGGCGG + Intergenic
1054489434 9:65762638-65762660 GGGGGCCGCGGCGGTGGGGGGGG - Intergenic
1054762323 9:69014122-69014144 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054798674 9:69325548-69325570 CGGGGCCGCGGCGGCAGCGGCGG - Intronic
1054835653 9:69672549-69672571 CGAGCCCGCGGCGGCGGCGGCGG + Intergenic
1055514208 9:77020320-77020342 CGTGGCGGCGGCGGCGGCGGCGG + Exonic
1055514229 9:77020412-77020434 CGCGGCCGCGGCGGCAGCGGCGG - Exonic
1055514232 9:77020421-77020443 CGTGGACGCCGCGGCCGCGGCGG - Exonic
1055757632 9:79572698-79572720 GGCGGCCGCGGCAGCGGAGGCGG - Exonic
1056369626 9:85941191-85941213 GGGGGCGGCGGCGGCCGAGGCGG + Exonic
1056746760 9:89310437-89310459 CGGAGCCGGCGCGGTGGCGGCGG - Intergenic
1057146817 9:92764372-92764394 GTGGGCCGCCGGGGCGGAGGGGG - Intronic
1057259663 9:93576663-93576685 CGGGGGCGGCGGGGCGCAGGCGG - Exonic
1057361148 9:94374755-94374777 CGGCGACGCCGCGGAGGCGGCGG - Exonic
1057463771 9:95292423-95292445 CGGGCCCGAGGCGGCGGCGGAGG - Intronic
1057489143 9:95508366-95508388 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1057662213 9:97013409-97013431 CGGCGACGCCGCGGAGGCGGCGG + Exonic
1057665241 9:97039349-97039371 CGGGGGCTGCGCGGAGGAGGGGG + Intronic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1057921970 9:99105101-99105123 CGAGGCCGCCGCGGCGGCTAGGG + Exonic
1058053285 9:100427253-100427275 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1058439084 9:104991216-104991238 CGGGGCCGGCGCTGGGGCGGGGG - Intergenic
1059283044 9:113150982-113151004 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1059483713 9:114611528-114611550 CGGGGTGGCGGCGGCGGCGGCGG + Exonic
1059769783 9:117414624-117414646 CGGGGACGCGGCGGCGGCGGCGG + Exonic
1060105182 9:120868945-120868967 GGGGTCAGCCGCTGCGGAGGTGG - Intronic
1060263166 9:122093181-122093203 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1060814068 9:126625699-126625721 GGCGGCGGCGGCGGCGGAGGTGG - Intronic
1060934905 9:127509142-127509164 CGGGGCCGCGGGGGCTGAGCAGG + Intronic
1060979891 9:127785894-127785916 GGGGGCAGCGGCGGCGGCGGCGG + Intronic
1061003810 9:127917095-127917117 CGGGGCCTGCGCGCCGCAGGCGG + Intergenic
1061052167 9:128203389-128203411 CGCGGCTGCAGCGGCGGAGCCGG + Exonic
1061450196 9:130663555-130663577 CGGGGCCGCAGCGGCCGTCGGGG - Intergenic
1061453500 9:130681620-130681642 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1061859366 9:133460251-133460273 TGGGGCCGCCGGGGCGGGGCGGG - Intronic
1061975829 9:134067723-134067745 CGGGGTCGCGGCGGCGGTGGCGG - Intronic
1061987091 9:134136175-134136197 CCGGGCCGCGGCGGCGGGGCCGG - Exonic
1062022523 9:134326237-134326259 CGGGGCGGCGGCGGCGGAGGGGG + Intronic
1062100355 9:134724803-134724825 AGGGGCCTCGGCGGGGGAGGTGG + Intronic
1062341422 9:136095322-136095344 CGGGGGCGGGGCGGCGGCGGGGG + Intergenic
1062498989 9:136844307-136844329 CGGGGCCTGGGCTGCGGAGGGGG + Intronic
1062500417 9:136849682-136849704 CGGGGCTGGCGGGGCGGGGGCGG + Intronic
1062507670 9:136886464-136886486 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1062547544 9:137070433-137070455 CGGGGCCGCCATGGCCGAGCGGG - Exonic
1062578812 9:137220917-137220939 CGGGGCCGCCGTGGCAGTGGCGG + Exonic
1062592270 9:137279676-137279698 CGAGGCCGCAGCGGCGCAGGCGG + Exonic
1062629975 9:137459153-137459175 CGCGGCTACCCCGGCGGAGGCGG - Exonic
1062696232 9:137877684-137877706 CGGGGCCGGCGCGGCAGGGTGGG + Intergenic
1202779847 9_KI270717v1_random:24375-24397 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1203731879 Un_GL000216v2:98813-98835 CTGGGCCCCGGCGGCGGAAGGGG - Intergenic
1203469883 Un_GL000220v1:111690-111712 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203470680 Un_GL000220v1:114192-114214 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203477704 Un_GL000220v1:155662-155684 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203478501 Un_GL000220v1:158164-158186 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1185464443 X:346367-346389 CGGGGCCGCCAGGGCACAGGCGG + Intronic
1186768057 X:12791455-12791477 GGGGCGCGCGGCGGCGGAGGAGG - Exonic
1187281595 X:17861417-17861439 CGAGGAGGCGGCGGCGGAGGAGG + Intergenic
1187363689 X:18649972-18649994 CGGGGCGGCGGCGGCGGGTGGGG - Intronic
1187648323 X:21374140-21374162 CGCGTGCGCGGCGGCGGAGGCGG - Intergenic
1188005497 X:25013547-25013569 AGGGGCCGCCGCGGCAGCCGCGG - Exonic
1188506431 X:30889258-30889280 GGGGGCGGCGGCGGCGGCGGCGG - Intronic
1189323072 X:40097810-40097832 GCGGGCGGCGGCGGCGGAGGGGG - Intronic
1189325562 X:40109016-40109038 CGGGAACGCGGCGGCGGCGGCGG + Intronic
1189418455 X:40834532-40834554 AGGAGCAGCAGCGGCGGAGGCGG + Intergenic
1189794349 X:44633344-44633366 CGCGGCAGCAGCGGCGGCGGTGG + Intergenic
1190526310 X:51332680-51332702 CGGGCCCGCCGGAGTGGAGGAGG - Intronic
1190542929 X:51496707-51496729 CGGGCCCGCCGGAGTGGAGGAGG + Intergenic
1190713061 X:53083061-53083083 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1192657068 X:73003303-73003325 GGAGGCCTCCGTGGCGGAGGCGG + Intergenic
1192665052 X:73079698-73079720 GGAGGCCTCCGTGGCGGAGGCGG - Intergenic
1192782038 X:74304214-74304236 CGGGGCCTCCGGGGCCGAGGTGG + Exonic
1192818004 X:74614459-74614481 CGGAGCAGCCTCGGCGGCGGCGG - Exonic
1192925001 X:75747085-75747107 CGCGGCGGCGGCGGCGGTGGCGG - Intergenic
1192925004 X:75747091-75747113 GGCGGCCGCGGCGGCGGCGGCGG - Intergenic
1192925005 X:75747094-75747116 GGCGGCGGCCGCGGCGGCGGCGG - Intergenic
1193654990 X:84187988-84188010 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1193654992 X:84187994-84188016 GGGGGTCGCGGCGGCGGCGGCGG - Intergenic
1194977592 X:100409719-100409741 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1195138205 X:101931888-101931910 CGCGGCAGCGGCGGCGGCGGCGG - Intronic
1195668346 X:107449906-107449928 CGGCGCAGCGGCGGCGGCGGCGG - Intergenic
1195668347 X:107449909-107449931 CGGCGGCGCAGCGGCGGCGGCGG - Intergenic
1195954794 X:110317830-110317852 CAGGGCTGCGGCGGCGGCGGCGG - Exonic
1196031113 X:111096439-111096461 CCGGGCTACCGCGGGGGAGGGGG + Intronic
1196389353 X:115191746-115191768 CGGAGCCACCGCTACGGAGGAGG + Exonic
1196389460 X:115192256-115192278 CGGAGCCACCGCTACGGAGGAGG + Exonic
1196719347 X:118839385-118839407 CTGGGCCCCCGCGGCGGAAATGG - Intergenic
1196734982 X:118975203-118975225 GGGGGCCGCCGCGGCTGCGGCGG + Exonic
1196808025 X:119605911-119605933 AGGGGCGGCAGCGGCGGCGGCGG + Intergenic
1198683349 X:139204323-139204345 CGGGATCGCGGCGGCGGCGGCGG - Intronic
1198767094 X:140091340-140091362 CGAGGCGGCGGCGGCGGCGGCGG + Intergenic
1199445106 X:147912049-147912071 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1199445111 X:147912064-147912086 GGCGGCGGCGGCGGCGGAGGCGG + Exonic
1199500368 X:148500672-148500694 CGGGGCGGCAGCGGCGGCGGCGG - Exonic
1199612731 X:149631762-149631784 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1200000275 X:153056556-153056578 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1200002599 X:153069707-153069729 GGGGGCGGCCGAGGCGGGGGGGG + Intergenic
1200005125 X:153080303-153080325 GGGGGCGGCCGAGGCGGGGGGGG - Intergenic
1200092481 X:153642413-153642435 GGAGGCAGCGGCGGCGGAGGCGG + Intergenic
1200098175 X:153673833-153673855 CGGGGCCGGCGGGGCGCGGGCGG - Intronic
1200100743 X:153688275-153688297 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1200155582 X:153972939-153972961 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1200173766 X:154097639-154097661 CGGCGCGGCGGCGGCGGCGGCGG + Exonic
1200550306 Y:4570988-4571010 CGGGCCAGCAGCTGCGGAGGGGG + Intergenic