ID: 985507605

View in Genome Browser
Species Human (GRCh38)
Location 5:292798-292820
Sequence GGATTTAAACAGAGGAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 2, 1: 3, 2: 7, 3: 14, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985507602_985507605 7 Left 985507602 5:292768-292790 CCGTCTCTGAGTCGGGTGGGGAT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 985507605 5:292798-292820 GGATTTAAACAGAGGAACCATGG 0: 2
1: 3
2: 7
3: 14
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985507605 Original CRISPR GGATTTAAACAGAGGAACCA TGG Intronic
900078688 1:838286-838308 GAACTTAAACAGAGGGAACAAGG + Intergenic
903425554 1:23251627-23251649 GGATTTCAACATAGGAATCGAGG + Intergenic
903658440 1:24962861-24962883 GGTTTAAAACAAAGGAACCTTGG - Intronic
903776520 1:25797565-25797587 GGATTTGAGCAGAGGGACCCGGG - Intergenic
904486057 1:30825087-30825109 GGATTAAAATAGAGGGAGCACGG + Intergenic
904904135 1:33882051-33882073 GGATTTATACCAAGGAACTAGGG - Intronic
906588610 1:47002567-47002589 GGATGTAAACAGTAGAAACAAGG - Intergenic
907454581 1:54567120-54567142 ACATTTAAAGAGAGGAATCAAGG - Intronic
908178494 1:61579979-61580001 GGATTTTAACAGTTGGACCAGGG - Intergenic
908407438 1:63829179-63829201 GGAATCAAACAAAGGATCCAAGG - Intronic
908445827 1:64198767-64198789 AGATTTAAAAAGAGGAAGAAAGG + Intergenic
908646636 1:66285548-66285570 GGAGTTAAACAGTGGACACATGG - Intronic
909352105 1:74665942-74665964 GGATTTAGACAGAAGAAATAAGG + Intronic
911115852 1:94246686-94246708 TGGTTTAAACAGAGCAGCCAAGG - Intronic
912012754 1:104989794-104989816 GAATTTAAACAGAGGTATCAAGG + Intergenic
916316643 1:163455722-163455744 GTTTTAAAACAGAAGAACCAGGG + Intergenic
918659209 1:187068761-187068783 GAATTTCAACAGAGAAACGATGG - Intergenic
920235087 1:204497501-204497523 GGAGCTCAACAGAGAAACCATGG + Intergenic
922113787 1:222589684-222589706 CCATTTAAACGCAGGAACCACGG + Intronic
1062896350 10:1106207-1106229 AGATTAAAAGAGAAGAACCAGGG - Intronic
1063077911 10:2734806-2734828 GGAAATAAAGAGAGGAGCCAGGG + Intergenic
1063388753 10:5634665-5634687 GGATTTGAACACAGGAATCTGGG + Intergenic
1063849280 10:10165973-10165995 GCATTTAGAAAAAGGAACCAGGG + Intergenic
1064727414 10:18294859-18294881 GGATTTGAACAGAGGAATTGAGG - Intronic
1066376134 10:34859005-34859027 GGATATAAAAAGATGAACAAGGG - Intergenic
1066413101 10:35192758-35192780 GGATTTCAACAGAGGAAATTGGG + Intronic
1067176495 10:43953413-43953435 GAAGTTTGACAGAGGAACCAGGG - Intergenic
1067533980 10:47094702-47094724 GGATTTCAGCAGAGGAAGAAAGG + Intergenic
1068961524 10:62871576-62871598 GTATTGAAACAGAGGTACCGAGG + Intronic
1071722531 10:88161983-88162005 TGATTTATTCAGAGCAACCATGG - Intergenic
1072981424 10:100101034-100101056 GGATCTAAACAGTGGAAGGAAGG - Intergenic
1076414628 10:130277066-130277088 GGATTTAAACAGTGGGAAGATGG + Intergenic
1076935186 10:133564082-133564104 GGATTTCAACATACGAACTATGG - Intronic
1077401544 11:2360578-2360600 GGATTGATCCAGAGGACCCAGGG + Intergenic
1077639818 11:3871322-3871344 GGCTTGGGACAGAGGAACCAGGG + Intronic
1077716931 11:4590600-4590622 GAATTTAAACAGGGCAGCCAGGG + Intergenic
1080290058 11:30660887-30660909 GGTCTTCAACAGAGGAGCCAGGG - Intergenic
1081633493 11:44705140-44705162 GTATTTAAACAGGGGGACCCAGG - Intergenic
1082982238 11:59134339-59134361 GCATTTAATAAGAGGACCCATGG - Intergenic
1083667072 11:64281431-64281453 GGATTTGAGCAGAGGCAGCATGG - Intronic
1084839540 11:71833819-71833841 GAATTTAAACACAGGAACCAGGG + Intronic
1085329504 11:75636198-75636220 GGATATAAACAGAATAAACATGG + Intronic
1085500401 11:77016750-77016772 GGATGTGAAGATAGGAACCAAGG - Exonic
1087948148 11:104190231-104190253 GGATGTAGAAAGAGGAACAATGG + Intergenic
1088733133 11:112701303-112701325 GGACATAAACACAGGAACAATGG - Intergenic
1090449488 11:126793587-126793609 TGACTCACACAGAGGAACCAAGG + Intronic
1090940413 11:131383064-131383086 GGATTTAAACAATGGACACAGGG - Intronic
1093307127 12:17534758-17534780 GATTTTTAACAGAGGTACCAAGG - Intergenic
1094633564 12:32202153-32202175 GGACTTAGAGAGAGGAAGCATGG + Intronic
1098665991 12:73163518-73163540 GGAAGCAAACAGAGAAACCAAGG - Intergenic
1099645218 12:85344458-85344480 GAATTTTAACAGGGGTACCAGGG + Intergenic
1100707619 12:97219080-97219102 GGATTTAAAGAGAGGAGTCAGGG - Intergenic
1101009429 12:100434170-100434192 GGATTTATCCATAAGAACCATGG - Intergenic
1102452596 12:113053016-113053038 TGATTAAATCAGAGGAAACAGGG - Intergenic
1102510947 12:113415005-113415027 GGTTTTCAATAGAGGGACCAGGG - Intronic
1102674859 12:114650505-114650527 GGGTAAAAACAGAGGACCCAAGG + Intergenic
1106198832 13:27519084-27519106 GATTTTCAACAAAGGAACCAAGG + Intergenic
1107183759 13:37493379-37493401 GGATTTAAACCAAGGCAGCACGG - Intergenic
1111516009 13:89332106-89332128 GGATTTAATCAGAGGAAACCAGG + Intergenic
1111785689 13:92783913-92783935 GGATTTAAACAGAAGTAAAATGG - Intronic
1111867751 13:93791002-93791024 GTTTTTGAAAAGAGGAACCATGG + Intronic
1111889251 13:94061246-94061268 GGATATAAACAGAGTAACAAGGG - Intronic
1113903726 13:113809646-113809668 GGAGTAAAACTCAGGAACCACGG - Intronic
1113903736 13:113809689-113809711 GGAGTAAAACTCAGGAACCACGG - Intronic
1115751271 14:36492971-36492993 GCAATAAAACAGAGGAAGCAGGG - Intronic
1118079249 14:62339363-62339385 AGATTTAGACAGGAGAACCAGGG - Intergenic
1119082482 14:71708708-71708730 AAATTTATACAGAGGTACCAAGG - Intronic
1119991205 14:79199732-79199754 AGATTCAAACAGACAAACCATGG + Intronic
1122068123 14:99187851-99187873 GGATTTAAAGAAAGGAAAGATGG - Intronic
1124788237 15:32701731-32701753 GGATTAGAACAGAGAAACCTGGG + Intergenic
1124802789 15:32850518-32850540 GGATTTAAACAGAAAACCCAAGG + Intronic
1126222564 15:46231219-46231241 GGATTTAAAGTGAGGCACAAAGG - Intergenic
1126437254 15:48648047-48648069 GGATCTGAGCAGAGGGACCATGG + Intergenic
1127344755 15:58083280-58083302 GGATTTCAACACATGAACTAAGG + Intronic
1131232863 15:90672124-90672146 GGATTTCAACAGATGAATCTGGG - Intergenic
1133327216 16:4949098-4949120 GGATGCAGACAGAGGAACCTGGG - Intronic
1135718706 16:24795581-24795603 GGATTAAAAGTGAGGAACCTTGG - Intronic
1136225330 16:28856648-28856670 GGATTTATAGAGTGGCACCAAGG - Intronic
1139130437 16:64136253-64136275 GGGTTTGAACAGAGGAAGTAGGG + Intergenic
1140821100 16:78664135-78664157 GGAGTTAAAGAGAGCAACTAAGG + Intronic
1140822647 16:78677764-78677786 GTATTAAAACAGAGGAAACATGG + Intronic
1142258406 16:89028544-89028566 GGATTTTAACAGCTGCACCAAGG + Intergenic
1142401081 16:89859079-89859101 GGAATGAAGCAGAGGACCCAGGG - Intronic
1143303396 17:5927641-5927663 GGATTTAAGCAGAGGAAGGTTGG + Intronic
1143390956 17:6558942-6558964 AGGTTTAAAGAGGGGAACCATGG - Intergenic
1147476440 17:40715907-40715929 GTTTTTAAAAAGAGGAATCAGGG - Intergenic
1151023500 17:70648715-70648737 GACTATAAACAAAGGAACCAGGG + Intergenic
1152460126 17:80438233-80438255 GGATTGAAGCAGGGGAAACAGGG + Intergenic
1153372046 18:4329285-4329307 GGCTTTTAACAAAGGACCCAGGG - Intronic
1153503680 18:5773372-5773394 GGATATAAACAGATGAATGAAGG - Intergenic
1156042196 18:32835326-32835348 GTTTTTAACCAGAGCAACCAGGG + Intergenic
1159492448 18:69154913-69154935 GGATCAAATCAGAGAAACCAGGG + Intergenic
1159765055 18:72479548-72479570 GGATTTCAACAGAGAACCAATGG - Intergenic
1160051497 18:75438262-75438284 GGAGTGAAAGAGAGGAGCCAAGG + Intergenic
1160175820 18:76593114-76593136 GGATTTTAACACAGGGCCCAGGG - Intergenic
1160293656 18:77618025-77618047 GGATTGAAACAGAAGACACAGGG + Intergenic
1162552919 19:11367823-11367845 GGATTTCAACATATGAACCGGGG + Intergenic
1163737495 19:18990363-18990385 GGCTGTTGACAGAGGAACCATGG + Intergenic
927145472 2:20162660-20162682 GGAAATAAACAGAGAAGCCAAGG - Intergenic
927906468 2:26862137-26862159 GGCTCTAAGCAGAGGACCCAGGG + Intronic
928316366 2:30249733-30249755 GCATTTAGAGTGAGGAACCAAGG - Intronic
931044622 2:58336911-58336933 GTTTTTAAACAGAGAAGCCATGG - Intergenic
932197888 2:69799962-69799984 GGATTAAAACAGATAACCCATGG - Intronic
932735080 2:74248666-74248688 GGAATTAAACAGAGTGACAATGG - Intronic
935326940 2:101946111-101946133 GGATTTCAACAGAGGAATTTGGG - Intergenic
935553190 2:104479831-104479853 GGATTTCAACAGAGGAATTTGGG - Intergenic
935730546 2:106061701-106061723 GGATTTAAACAGATGAAATTTGG + Intergenic
936631905 2:114212482-114212504 GGAAGTAAACAAAGGAACAAAGG - Intergenic
937577935 2:123447147-123447169 GGGTTTTAACTGAGGAACCGTGG - Intergenic
938162923 2:129002754-129002776 GGATTTCAACAAAGGAATCTTGG - Intergenic
939864477 2:147457679-147457701 GTTTTTAAACAGAGGATGCAGGG - Intergenic
940692744 2:156939793-156939815 GAATTTAAACTGAGGGAGCATGG - Intergenic
940831840 2:158475225-158475247 AGATTTAAAAAGTGGCACCAGGG - Intronic
941081372 2:161064810-161064832 GGTTTTAAACACAGGAAAGATGG + Intergenic
941132102 2:161664144-161664166 GGATTTAAAAAAAAGAATCAGGG - Intronic
941607670 2:167620463-167620485 GGTTTTAAGCAGAGGCATCATGG + Intergenic
942159264 2:173165085-173165107 AGATATAAACGGAGGAATCAAGG - Intronic
942552260 2:177131649-177131671 GGAGGAAAAAAGAGGAACCAAGG + Intergenic
942644191 2:178093137-178093159 GGATTTCTACAGAGAAGCCAAGG - Intronic
942885001 2:180912414-180912436 GGATTGACACAGAAGAGCCAAGG + Intergenic
945171377 2:207000239-207000261 GATTTTCAACAAAGGAACCAAGG + Intergenic
945452238 2:210007053-210007075 GGAATTAAACATAGGCACTATGG - Intronic
946223733 2:218250778-218250800 GAATTTCATCAGAAGAACCAAGG - Intronic
947778360 2:232733525-232733547 TCATTTAAACAGAGGCAACAGGG + Intronic
949071524 2:242027901-242027923 GGATTTAAACGGAGGAACTGTGG + Intergenic
1168939487 20:1696542-1696564 GGAGTTAAATTGAGGAACCTGGG + Intergenic
1169719163 20:8654390-8654412 GGATTAAAACAGAAGACCCAAGG + Intronic
1170061067 20:12259919-12259941 GGATTCAAAAAGCGGAACCCAGG - Intergenic
1173362990 20:42361059-42361081 GGATGTGCACAGAGGAGCCAAGG - Intronic
1174391769 20:50222176-50222198 GGTTCTAAACAGAGGAAAGATGG - Intergenic
1174700643 20:52605116-52605138 GGATTTCAACATAGGAACTTTGG - Intergenic
1175352227 20:58331870-58331892 GTATTTAAACAGAGACACCTGGG + Intronic
1175720217 20:61281223-61281245 GGATTTCAACACAGGAATCTGGG - Intronic
1178473263 21:32913940-32913962 CGATTTCCACAGAGGTACCAGGG + Intergenic
1184466801 22:44673229-44673251 GGCTGTAAGCAGTGGAACCAGGG - Intronic
1185139833 22:49094053-49094075 GAATTTAAAAAGAGGAAGGAAGG + Intergenic
1185354932 22:50362603-50362625 GGATTTCAACATAGGAATCTGGG - Intronic
949265943 3:2156251-2156273 GGATTCAAAAAACGGAACCATGG + Intronic
950997888 3:17524095-17524117 AGATTTAAAGAGATGAACGAAGG + Intronic
951604374 3:24416464-24416486 GGATTAAAAAGGAGGAACAAGGG + Intronic
952189338 3:31005840-31005862 GGATTTAAACAGAAGAAATTAGG - Intergenic
952323870 3:32302877-32302899 GAATTTGAACAAAGGAACCCTGG + Intronic
953284313 3:41591600-41591622 GGATTTAGACAAAGGAATGAAGG + Intronic
955315905 3:57938801-57938823 GCATTTAAAAAGAAGAACCCTGG - Intergenic
956542712 3:70360456-70360478 TGTTTTAAACTGAGGCACCAGGG + Intergenic
956728767 3:72177826-72177848 GGAGTTAACCACAGAAACCACGG - Intergenic
956763834 3:72467146-72467168 GGATTCACACTGAGGAAACAGGG + Intergenic
960695001 3:120387604-120387626 GGATTTAAACCCAGGAAACCTGG + Intergenic
960957838 3:123046810-123046832 GGATTTAAAGAGAGCAATAAAGG - Intergenic
961442890 3:126963149-126963171 GGATTTAAACTGAGGCCCCCAGG - Intergenic
961698464 3:128723279-128723301 GGAGGAAACCAGAGGAACCAAGG + Intergenic
962220922 3:133564200-133564222 GGTTTTAAACAGAGGAGTGATGG + Intergenic
965078374 3:164006127-164006149 GCATTTAAACATAGGAATTAAGG + Intergenic
968050978 3:195654782-195654804 GGATTTAAACAGAGGAACCGTGG + Intergenic
968104847 3:195993556-195993578 GGATTTAAACAGAGGAACCGTGG - Intergenic
968303143 3:197631140-197631162 GGATTTAAACAGAGGAACCGTGG - Intergenic
969780627 4:9399823-9399845 GAATTTAAACACAGGAAGCAGGG + Intergenic
970705548 4:18797319-18797341 GGAATAAAACAGAAGGACCATGG + Intergenic
971893831 4:32563440-32563462 GTATTTCAAAAAAGGAACCATGG - Intergenic
972943810 4:44228980-44229002 GGATTTAAACTGAGGAAGTCTGG - Intronic
974500422 4:62693221-62693243 TGATTTAAAAAGGGGAAGCAAGG + Intergenic
974683850 4:65197873-65197895 GGATTCAAACACAGTTACCATGG - Intergenic
975077805 4:70234528-70234550 GGACTGAATCAGAGTAACCAAGG + Intronic
978312461 4:107399652-107399674 TGATTTAATAAGAGGAACAAGGG - Intergenic
979546188 4:121942669-121942691 GTATTTAAGGAGAGGAACCCTGG + Intronic
980229941 4:130036143-130036165 GGATTTAAACATAGATACAATGG + Intergenic
980429372 4:132671582-132671604 GGACATAAACAGGGGAACAATGG + Intergenic
980717475 4:136646082-136646104 TGATTTAGACATAGAAACCAAGG + Intergenic
981965339 4:150593464-150593486 GGATTTAAAAACAGGCAGCACGG + Intronic
982739343 4:159041527-159041549 GGAGTTAACCAAAGGTACCAGGG + Intergenic
982885631 4:160777200-160777222 GGATTTAAACTCAGGAACCATGG + Intergenic
983536861 4:168867046-168867068 GGATTTAAACTGAGGAGCTCTGG - Intronic
983692233 4:170484057-170484079 GGATGCAAACAGAGACACCAGGG + Intergenic
984559786 4:181254786-181254808 TGCTTTAAATAAAGGAACCAGGG + Intergenic
985166997 4:187107255-187107277 GGATTTGAACAGAGGAGGCAGGG - Intergenic
985507605 5:292798-292820 GGATTTAAACAGAGGAACCATGG + Intronic
985740368 5:1612331-1612353 GGATTTAAACAGAGGAACCATGG - Intergenic
985927687 5:3030535-3030557 GGATTTCAACAGAGGAATTTGGG - Intergenic
989006986 5:36826257-36826279 GAATTTAAACTGAGGAAGGAGGG + Intergenic
990317848 5:54600998-54601020 TGATTTAAAAAGATGAACTATGG + Intergenic
990715509 5:58632265-58632287 TAATTTTAACATAGGAACCATGG + Intronic
990995774 5:61730933-61730955 GTGTTTAAGCAGAGGCACCATGG - Intronic
992705274 5:79384810-79384832 GGATTTATACCAAGGAAACAAGG + Intronic
993435943 5:87894242-87894264 AAATTTAAACAGAGGAACAGAGG - Intergenic
994389828 5:99178784-99178806 TGCTTTAAACATAGGAACTAAGG + Intergenic
994864071 5:105241996-105242018 GGAGTTAAAATGAGGATCCAAGG + Intergenic
995860722 5:116637563-116637585 GGAAATAAACAGAGGCACAAAGG - Intergenic
996188803 5:120513331-120513353 GGATATAAACAGAGGAATTGAGG - Intronic
998310555 5:141125371-141125393 AGATTTAAACAGAATAGCCAAGG - Exonic
1002598686 5:180340921-180340943 GGATTTCAACAGATGAATGACGG + Intronic
1002897615 6:1388867-1388889 GGATTTACACTGAGAAACCTAGG - Intergenic
1003621430 6:7704510-7704532 GGATTTCAACAGATGAATTAGGG - Intergenic
1003982725 6:11404584-11404606 GCATTTAAAGAAAGGCACCAAGG - Intergenic
1004745581 6:18506013-18506035 GAATTGAAACAGAGGAAGTAAGG + Intergenic
1006401584 6:33820973-33820995 GGATTTACAAAGAGGACACAAGG + Intergenic
1006870220 6:37244596-37244618 TGATTTAAGCAGAAAAACCATGG + Intronic
1007453416 6:41957598-41957620 GGATTTATTCACAGGAAACAAGG - Intronic
1008186567 6:48399651-48399673 GGATTTCAAGAGAGAAATCAAGG - Intergenic
1008262593 6:49385465-49385487 GAATGGAAACAGAGGAAGCAAGG + Intergenic
1008703246 6:54127045-54127067 GCATTTGACCAGAGGAATCAAGG - Intronic
1009697810 6:67132131-67132153 GTATTTAATAAGATGAACCATGG - Intergenic
1010565044 6:77400623-77400645 GGATTTAAAAAGGGGAACCTTGG - Intergenic
1011007751 6:82666711-82666733 AGATTTACACTGAGGAAACATGG - Intergenic
1011322266 6:86108771-86108793 CGATTCAAACAGAGGCAGCATGG - Intergenic
1014866393 6:126535738-126535760 GGATTTAAACACAGGGGCCTGGG - Intergenic
1015224438 6:130840890-130840912 GAATTTAAAGACAGAAACCAAGG + Intronic
1015467742 6:133566599-133566621 GGAATTAAAAAGAGGCACCCTGG - Intergenic
1015928252 6:138331495-138331517 GCATTTAAATAGAGAAACCTGGG + Intronic
1016633716 6:146262003-146262025 GAATTTAAAGAGAGGCACCTGGG + Intronic
1017779803 6:157707047-157707069 AGAATTAAACAGAGACACCATGG - Intronic
1018027039 6:159814687-159814709 GGATTTAAACCCAGGAAGCCTGG - Intronic
1020359111 7:7308168-7308190 TTGTTTAAATAGAGGAACCAGGG - Intergenic
1020781365 7:12519819-12519841 GGATATAAACAGAGGTTCCCAGG + Intergenic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1032435019 7:131893553-131893575 AGATTTATACAGAAGAACCTTGG - Intergenic
1032546810 7:132750782-132750804 GGACTTACCCAGAGAAACCAGGG - Intergenic
1033462936 7:141563786-141563808 GGAAGAAAACAGAGGAGCCAAGG - Intronic
1034888961 7:154822496-154822518 GGATTTCAACAGAGGAATCTAGG + Intronic
1035526955 8:321459-321481 GAAATTAAACAGAGGGAACAAGG - Intergenic
1036278062 8:7373756-7373778 GAATTTAAACACAGGAACCAGGG + Intronic
1036343461 8:7938136-7938158 GAATTTAAACACAGGAACCAGGG - Intronic
1036838802 8:12098900-12098922 GAATTTAAACACAGGAACCAGGG - Intergenic
1036860590 8:12345143-12345165 GAATTTAAACACAGGAACCAGGG - Intergenic
1037913294 8:22757132-22757154 GGATTTTAAAAGATGAACCCTGG - Intronic
1039010282 8:33086184-33086206 GGGTTCACACAGAGAAACCAAGG + Intergenic
1041113400 8:54508972-54508994 GTCTTTAAAAAGAGAAACCAGGG + Intergenic
1041827505 8:62112915-62112937 GAATTTCAACAAAGGGACCAAGG - Intergenic
1042483516 8:69328494-69328516 GGATTTAAACAAAGGAACCGTGG + Intergenic
1044282292 8:90370359-90370381 GGATTTCAACAGACTACCCAGGG + Intergenic
1044606947 8:94056315-94056337 GGTTTTAAGCAGAGGTAACATGG - Intergenic
1046290156 8:112148717-112148739 ATATTTAAACAGAGGAAACTGGG - Intergenic
1046317650 8:112528373-112528395 GGATTTAAACACAGTAAACCAGG + Intronic
1046553838 8:115751666-115751688 GAATTTAAACAGAGGAGGGAGGG - Intronic
1047148875 8:122238105-122238127 GGATTTCAACATAGGAATCTGGG + Intergenic
1047793054 8:128224992-128225014 GGATTTAGACAGGTGAATCAAGG - Intergenic
1057762747 9:97889843-97889865 GGATTTCAACACATGAACTAGGG + Intergenic
1058738084 9:107914813-107914835 TGATTTCAACAAAGGAAGCAAGG + Intergenic
1060121189 9:120991299-120991321 GGATTTATACAGAGTTTCCAGGG + Intronic
1060240952 9:121902742-121902764 GGAGTTAAACAGCAGACCCAGGG + Intronic
1060254407 9:122014512-122014534 GGAATTAAACACAGGCACTATGG - Intronic
1060396476 9:123320078-123320100 GGTTTTAGACAGAGGGACCCAGG - Intergenic
1061571163 9:131478176-131478198 GGCTTTAAAGAGAGGAAGCCTGG + Intronic
1185671011 X:1810259-1810281 GGATTTCAACACAGGAATGATGG - Intergenic
1185789966 X:2921690-2921712 GGATGTGAACAGAAAAACCAAGG - Intronic
1186351205 X:8741735-8741757 GGATGTAAAAAGAGGCTCCAGGG - Intergenic
1186608417 X:11114699-11114721 AGATTTAAACAGAAGAAACCTGG + Intronic
1186673255 X:11788658-11788680 GCTTTTGAACATAGGAACCAAGG - Intergenic
1186782112 X:12923454-12923476 GGACTGATGCAGAGGAACCAAGG - Intergenic
1187096313 X:16152215-16152237 GGAGAGAGACAGAGGAACCAAGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187795107 X:22994888-22994910 GGATTTCAACATAGGAACTTCGG + Intergenic
1189115108 X:38334294-38334316 GGATTTGAACACAGGAAGCCTGG + Intronic
1189548823 X:42072161-42072183 GGATTTCAACATAGGAATCTGGG - Intergenic
1190093899 X:47463626-47463648 GGAAGTAACCAGAGGAACTAGGG - Intronic
1195504686 X:105643732-105643754 GGGTTTCAACAGAGGTGCCAAGG - Intronic
1195744864 X:108106726-108106748 AGATTTATTAAGAGGAACCATGG - Intronic
1196493639 X:116297709-116297731 GGCTTTCAACAGAGGATCCAAGG + Intergenic
1197078638 X:122384587-122384609 ATATTTAAACATATGAACCACGG + Intergenic
1199031894 X:143010517-143010539 GGATAAATACAGAGGAACTAGGG + Intergenic
1199622660 X:149713899-149713921 GGATGAAAACAGAGGAAGCAAGG - Intronic
1200325915 X:155238794-155238816 GGATGTAAAAAGAAGAAACAAGG + Exonic
1200390916 X:155945997-155946019 GGATTTAAAAAGAAAAAACATGG - Intergenic